1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Molodets [167]
3 years ago
13

What is soil made up of ?

Biology
2 answers:
Brrunno [24]3 years ago
5 0
The answer above is correct
raketka [301]3 years ago
3 0

Soil is made up of four major components.

  • 25% of water
  • 25% of air
  • 45% of rock particles
  • 5% of leaves
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What is an experiment topic
Zigmanuir [339]
Science experiments can be like “measuring how heart rate is effected by music “
5 0
2 years ago
Please answer quick and correctly
Georgia [21]

Answer:

d

Explanation:

3 0
3 years ago
How did fossil<br> fuels form, and how<br> are they obtained<br> and used?
Usimov [2.4K]

Explanation:

Fossil fuels are important energy sources for our every day activities.

  Formation of fossil fuels

Fossil fuels forms from the accumulation and burial of organisms in a basin of deposition. Instead of the organisms decaying, they preserve their carbon content. To be worthy of becoming fossil fuels, organisms must be buried in an environment where there is little to no oxygen to fast-track decomposition of the buried organic matter. Increase in temperature and pressure causes the organic matter to transform into fossil fuels.

How are they obtained

First, different fossil fuels have their extraction techniques because they occur in different physical state of matter.

For the solids e.g coal: exploration is carried out first and if a prospect is delineated, mining engineers design the best way to extract the coal from nature. Coal is usually found laid in sedimentary beds in nature. Top layers of sediments can be removed to extract the coal.

For fluids such as crude oil and natural gas, after a prospect is identified, a rig is usually constructed to extract the fluid and gas. The natural pressure allows for the fluids the rise within the drill used in extraction.

How are they used

Coal and gas are used to power electrical generating plants. They are used to heat steams which drives turbines and produce electricity.

Natural gas is used as a domestic fuel for cooking and so also coal.

When crude is processed a lot of product is obtained. Gasoline is used to power most internal combustion engines. Some chemicals useful for manufacturing plastics, drugs e.t.c are also derived from the processed crude.

Learn more:

Harnessing fossil fuel brainly.com/question/9231468

#learnwithBrainly

8 0
3 years ago
What type of relationship exists between tides and time?
Damm [24]
The relationship that exists between tides and time is that as night come tides expand and in the daytime tides contract
6 0
3 years ago
Other questions:
  • Which is a frameshift mutation?<br> a.)substitution<br> b.)nonsense<br> c.)silent<br> d.)deletion
    16·2 answers
  • Why is the sky blue?
    9·2 answers
  • List two human made disturbance that can lead to succession ?
    14·1 answer
  • How does the cycling of matter affect a food chain?
    13·1 answer
  • PLEASE HELP THIS IS MY LAST QUESTION
    15·1 answer
  • Topic: Enzymes and germinating seeds
    8·1 answer
  • How to find genotype/ phenotype of parents and the ratios.
    11·1 answer
  • How does photosynthesis work step by step
    15·2 answers
  • Mutations in the genes for clotting factor VIII and IX cause hemophilia A and B, respectively. A woman may be heterozygous for m
    14·1 answer
  • What is the powerhouse of the cell?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!