<span>The Golgi-Apparatus is the organelle that packages and distributes proteins that are received from the endoplasmic reticulum. It can be found in most eukaryotic cells, and was named after the Italian scientist Camillo Golgi who identified it in 1897. It is an important organelle whose function is also to process proteins for secretion, among other things. </span>
B.Liquid Water
Explanation: lava gushes out ashes go up and gases when it erupts only water does not erupt.
Because they’re green. grasshopper are also pretty small.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
you can't see sickle cell in a karyotype a it is inside one of the chromosomes
it is a single gene disorder
Explanation:
