1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
3 years ago
13

The region of the abdominopelvic cavity that is inferior and medial to the left lumbar region is the:

Biology
1 answer:
Kaylis [27]3 years ago
8 0

Answer:

The correct answer is - hypogastric region.

Explanation:

The hypogastrium (additionally called the hypogastric region or suprapubic locale) is an area of the abdomen situated beneath the umbilical region. The pubis bone comprises its lower limit. The underlying foundations of the word hypogastrium signify "beneath the stomach"; the foundations of suprapubic signify "over the pubic bone".  

The hypogastric region (beneath the stomach) contains the organs around the pubic bone. These incorporate bladder, some portion of the sigmoid colon, the anus, and numerous reproductive organs, for example, the uterus and ovaries in females and the prostate in guys.

Thus, the correct answer is - hypogastric region.

You might be interested in
What is the special feature of an egg cell?
Arturiano [62]
The human egg cell is the largest cell in the human body, measuring approximately 0.13 mm in diameter. Its size is 10 times the diameter and 1000 times the volume of most other human body cells. It can actually be seen without the aid of a microscope if one observes keenly. Unlike ordinary body cells which have a cell membrane, the egg has a special outer coat called zona pellucida which is made up of a jelly-like extracellular matrix composed mainly of glycoproteins.
3 0
3 years ago
How do scientists use weather variables to describe and predict weather?
andreyandreev [35.5K]
Temperature, pressure, wind speed and direction, cloud coverage,precipitation and humidity
8 0
4 years ago
Which of the following is an example of an extended product responsibility? Select one: a. ecotourism b. soft loans for business
igor_vitrenko [27]

Answer:

Which of the following is an example of an extended product responsibility? Select one:

a. ecotourism

b. soft loans for business planning to implement environmental products

<h2><em><u>c. the use of recycled wood products in the manufacture of new products </u></em></h2>

d. tradable emission permits

5 0
3 years ago
Summary of hearing: Vibrations cause the cochlea’s membrane to shake. This causes ripples in the ____________, bending the _____
mash [69]

Answer:

1) Basilar membrane

2) Stereocilia or hair cells

3) Nerve cells

4) Auditory

5) Temporal lobe

Explanation:

Basilar membrane: located inside of the cochlea which is located in the inner ear. This membrane separates two tubes that is filled with liquid which is also important for hearing.  

Hair cells: Connected to the basilar membrane and they acts as sensory receptors which can catch movements (ripples) in the basilar membrane and pass this message to the neurons.

Nerve cells: One of the main cell types in the brain, which are responsible for signal transfer.

Auditory cortex: This part of the brain is located in temporal lobe and handles the auditory information.

8 0
4 years ago
Describe the purpose of the of the glycoprotein spikes found on some enveloped viruses.
Ierofanga [76]
A peplomer is a glycoprotein spike on a viral capsid or viral envelope. These protrusions will only bind to certain receptors on the host cell; they are essential for both host specificity and viral infectivity.
4 0
4 years ago
Other questions:
  • Which one of these helps create water pollution?
    12·2 answers
  • What would happen if mitochondria were absent?
    13·2 answers
  • Which academic discipline studies the brain and its functioning
    7·1 answer
  • A young female is unconscious after intentionally ingesting a large amount of aspirin. You will MOST likely find her respiration
    15·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Draw A Punnett Square For Qq and QQ . Explain What The Punnett Square Represents. ​
    15·2 answers
  • Where in the digestive system is glucose absorbed into the bloodstream​
    11·2 answers
  • When maintaining homeostasis in mammals antidiuretic hormone ( ADH ) is essential . In response to elevated tissue osmolarity AD
    5·1 answer
  • As you carry out the steps below, record notes in
    13·1 answer
  • What specific changes in rachel’s muscle cells and kidney function are leading to elevated plasma k levels?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!