During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
They are an addition to your body that is not passed through DNA
Explanation:
The correct answer is A.
Water runoffs usually carry nutrients especially fertilizers from off the landscape and washed them into the wetlands and other water bodies. Phosphorus is a common ingredient that is present in all fertilizers. Phosphorus acts as a pollutant in these water bodies and put the organisms living in the water bodies at risk. High concentration of phosphorus causes rapid growth of plants in the wetlands and lead to depletion of oxygen leading to the death of organisms living in the wetlands.
Due to this occurrence, the Florida government has taken steps and enact several laws to ensure that the phosphorus pollution is arrested in order to preserve the wetlands.
May we have the choices but i will say human impact
do u mean microbial symbiosis?
Answer:
Symbiosis is a relationship between two organisms
Types of Interactions
Positive interaction: Mutualism, Syntrophism, Proto-cooperation, Commensalism
Negative interaction: Ammensalism (antagonism), parasitism, predation
