Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
a pore, found in the epidermis of leaves, stems, and other organs, that facilitates gas exchange. The pore is bordered by a pair of specialized parenchyma cells known as guard cells that are responsible for regulating the size of the stomatal opening.
Explanation:
Answer: If a cell has the ability to take in water, food molecule, and other necessary materials this indicates it is capable of nutrition. The answer can not be digestion or absorption because it's a term that talks about multicellular beings.
The correct answer would be the last one: "evolved from past organisms." This theory basically just states that all living organisms evolved from a single common ancestor. Hope this helped! :)