1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
3 years ago
8

Types of soil erosion

Biology
1 answer:
Daniel [21]3 years ago
6 0
Soil erosion can be caused by acid rain, mining, and water
You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
What is stomata ?<br> pls fast
zysi [14]

Answer:

a pore, found in the epidermis of leaves, stems, and other organs, that facilitates gas exchange. The pore is bordered by a pair of specialized parenchyma cells known as guard cells that are responsible for regulating the size of the stomatal opening.

Explanation:

8 0
2 years ago
Read 2 more answers
If a cell has the ability to take in water, food molecule, and other necessary materials this indicates it is cabable of
mojhsa [17]

Answer: If a cell has the ability to take in water, food molecule,  and other necessary materials this indicates it is capable of  nutrition. The answer can not be digestion or absorption because it's a term that talks about multicellular beings.

6 0
2 years ago
Read 2 more answers
How many chromosomes in the dna?​
wariber [46]
Should be 23 I think?
5 0
3 years ago
Darwin’s theory of common descent states that all organisms _____.
choli [55]
The correct answer would be the last one: "evolved from past organisms." This theory basically just states that all living organisms evolved from a single common ancestor. Hope this helped! :)
6 0
3 years ago
Read 2 more answers
Other questions:
  • Jill is 5 years old. She has been diagnosed with ADHD and shows signs of learning disabilities. Her doctor suggests that Jill's
    11·1 answer
  • What is true of a substrate?
    8·1 answer
  • Day and night are caused by A. the rotation of the Sun on its axis. B. the Sun completing a full orbit around the Earth. C. the
    6·2 answers
  • Brown eyes are dominant over blue eyes. If two brown eyed parents have a child with blue eyes, what does it mean about
    14·2 answers
  • Which of the following definitions best sums up the study of geography?. A. the study of biological processes in the human body.
    9·2 answers
  • What is the similarity between trenches and subduction zones?
    15·1 answer
  • Your teacher has asked you to complete labeling this plant cell. you know that plant cells have a nucleus. what two organelles s
    9·2 answers
  • What is the phenomenon that takes place at the level of the green leaves of the carrot
    9·1 answer
  • What is this? Please answer with an explanation
    9·1 answer
  • . The area of particle 1 is
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!