7. EVALUATING METHODS Clean rooms used

Biology

1 answer:

babunello [35]3 years ago

3 0

Answer:

Clean rooms are used for biological research in order to prevent the research from contamination of other microorganisms.

Explanation:

Rooms were cleaned before any biological research in order to reduce the intervention of other microorganisms in the research and made the research proof from any impurities. These labs have high atmospheric pressure which decline the growth of microbes and the research will be done in a better way.

You might be interested in

Angelica is a girl with blond hair and blue eyes. She is very popular in school but

Karolina [17]

Answer:

Yes they are wrong

Explanation:

I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.

5 0

3 years ago

What are the differences between photosystem l and photosystem ll?

Feliz [49]

Answer:

in ps1, reaction centre is p700

in ps2, reaction centre is p680

6 0

3 years ago

Jdr-wivg-vmb<br>co.me a.nd jo.in fa.st...<br>go.ogle me.et

stira [4]

Answer:

Explanation:

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What would happen to a food web if we remove the:

salantis [7]

C) Primary Producer. The producers are what make the food chain. Without them there would be no primary consumers. And without primary consumers there would be no secondary consumers.

3 0

4 years ago

Read 2 more answers