1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
8

Which pairings match protozoa with the structures they use to move? amoeba: flagellum; euglena: pseudopod; paramecium: cilia amo

eba: pseudopod; euglena: cilia; paramecium: flagellum amoeba: pseudopod; euglena: flagellum; paramecium: cilia amoeba: flagellum; euglena: cilia; paramecium: pseudopod?
Biology
2 answers:
Anna35 [415]3 years ago
7 0

Answer:

1.  Cillia - Paramecium

2. Flagellum - Euglena

3. Pseudopodia- Amoeba

VashaNatasha [74]3 years ago
3 0
The answer is Amoeba; pseudopod; Euglena; flagellum;  paramecium; cillia.
Protozoan are organism, usually single-celled and heterotrophic belonging to any of the major lineages of protists and, like most protist, protozoa are microscopic. all protozoans are eukaryotes and therefore possess a true or a membrane-bound nucleus. Examples of protozoa include; Amoeba, Euglena, Paramecium. They exhibit diverse modes of locomotion across the various groups, but the modes of locomotion can be broadly divided into flagellar, ciliary, and amoeboid movement.

You might be interested in
The glands located besides the thyroid are the _____ gland
levacccp [35]
The glands located besides the thyroid are the Parathyroid gland.
3 0
4 years ago
What evidence has allowed scientists to conclude that the common ancestor of modern chimps and humans lived around 7 million yea
tatyana61 [14]

Biological molecules such as proteins and DNA reveal differences between humans and chimps that would have taken around 7 million years to accumulate.

<h3>What is DNA?</h3>

All known animals and viruses have genetic information in the form of deoxyribonucleic acid, a polymer consisting of two polynucleotide chains that coil around one another to form a double helix. Ribonucleic acid is a type of nucleic acid, as is DNA.

The two DNA strands are known as polynucleotides because they are constructed from simpler monomeric units called nucleotides.

The four nucleobases that contain nitrogen—cytosine (C), guanine (G), adenine (A), or thymine (T)—along with deoxyribose and a phosphate group—make up each nucleotide. The sugar of one nucleotide and the phosphate of the following make covalent bonds, creating what is known as the phospho-diester linkage, which results in an alternating sugar-phosphate backbone.

To learn more about DNA visit:

brainly.com/question/264225

#SPJ4

8 0
2 years ago
Water is a ____ molecule
rusak2 [61]
Water is a H2o molecule
6 0
3 years ago
Are scientific theories absolute truths? Why or why not?
dexar [7]

A scientific theory can always be disproved if someone comes along with better evidence which shows another theory is true. However, most other theories are small improvements on existing ones. Evolution and natural selection (the theory that animals' populations change over time because their environment encourages specific different features for individuals that happen with mutation) was an improvement on the existing "theory" that animals were built to be fit for their environments. The earth rotating around the sun was a theory improving on the idea that the sun and the earth move around so that it looks like the sun moves around the earth. All of these happened because there was evidence, so while theories aren't always absolutely true, many modern theories are typically well-tested and if they aren't, they are usually refered to as hypotheses or models (although models can sometimes also be theories, like the Standard Model)

8 0
4 years ago
Read 2 more answers
WILL MARK BRAINLIEST!!!
wlad13 [49]

Answer:

A. Flat Model

B. Conic Projection

Explanation:

Conic map projections are designed to be able to be wrapped around a cone on top of a sphere (globe), but aren’t supposed to be geometrically accurate.

The distortion in a conic map makes it inappropriate for use as a visual of the entire Earth does make it great for use visualizing temperate regions, weather maps, climate projections, and more.

Conic map projections have parallels that cross the meridians at right angles with a constant measure of distortion throughout.

(NOT highly distorted that would be a Cylindrical Map Projections which is not on your list)

Hope this helps <3

6 0
3 years ago
Read 2 more answers
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • During the past decade, doctors have noted the appearance of several super bugs, which are bacteria that show multiple resistanc
    12·1 answer
  • Continuous capillaries are the most common capillaries in the body. T/F
    10·1 answer
  • Glucose, a carbohydrate, readily dissolves in your bloodstream. cholesterol and triglycerides—both lipids—are packaged inside th
    5·1 answer
  • A mutation has occurred in an animal population so that the homozygous recessive condition (ff) is a fatal disease for the anima
    14·1 answer
  • Which immunosuppressive drug is used to kill rapidly dividing cells?
    14·1 answer
  • I'll make u the Brainliest 
    9·1 answer
  • A severe fever of 106º F (41º C) will Two of the answers are correct. increase uncatalyzed reaction rates by increasing the kine
    10·1 answer
  • I will give anyone who answers this fast and correctly a brainliest on this and go to your account and give 5 stars/thanks on al
    7·2 answers
  • 2 forms of the same gene is?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!