1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
14

2. What are the two major subdivisions of the nervous system, and what does each division do?

Biology
1 answer:
irinina [24]3 years ago
6 0

Answer:

2 Major Subdivisions:

Central Nervous System

Peripheral Nervous System

Explanation:

The central nervous system (CNS) regulates the majority of bodily and mental activities. It is divided into two parts: the brain and the spinal cord. The brain is the core of our ideas, the translator of our surroundings, and the source of control over physical action.

The PNS is the nerve that links the CNS to the rest of the body. The peripheral nervous system's principal job is to link the brain and spinal cord to the rest of the body and the outside world. The peripheral nervous system sends and receives information to and from the central nervous system. This is done by neurons that convey information from sensory receptors in the eyes, ears, skin, nose, and tongue, as well as stretch receptors and nociceptors in muscles, glands, and other internal organs.

You might be interested in
Write a summary about the cell theory
julia-pushkina [17]

Answer:

Over the next two centuries after the discoveries of Hooke and Leeuwenhoek, biologists found cells everywhere. Biologists in the early part of the 19th century suggested that all living things were made of cells, but the role of cells as the primary building block of life was not discovered until 1839 when two German scientists, Theodor Schwann, a zoologist, and Matthias Jakob Schleiden, a botanist, suggested that cells were the basic unit of structure and function of all living things. Later, in 1858, the German doctor Rudolf Virchow observed that cells divide to produce more cells. He proposed that all cells arise only from other cells. The collective observations of all three scientists form the Cell Theory, which states that:

all organisms are made up of one or more cells,

all the life functions of an organism occur within cells,

all cells come from preexisting cells.

Though no one point of the Cell Theory is more important than another, the theory clearly states that the functions necessary for life occur in the cell. Findings since the time of the original Cell Theory have enabled scientists to "modernize" the theory, including points related to biochemistry and molecular biology. The modern version of the Cell Theory includes:

all known living things are made up of one or more cells,

all living cells arise from pre-existing cells by division,

the cell is the fundamental unit of structure and function in all living organisms,

the activity of an organism depends on the total activity of independent cells,

energy flow (metabolism and biochemistry) occurs within cells,

cells contain hereditary information (DNA) which is passed from cell to cell during cell division,

all cells are basically the same in chemical composition in organisms of similar species.

The Cell Theory is one of the main principles of biology. The points of the theory have been found to be true for all life. As with any scientific theory, the Cell Theory is based on observations that over many years upheld the basic conclusions of Schwann’s 1839 paper. However, one of Schwann’s original conclusions stated that cells formed in a similar way to crystals. This observation, which refers to spontaneous generation of life, was discounted when Virchow proposed that all cells arise only from other cells. The Cell Theory has withstood intense examination of cells by modern powerful microscopes and other instruments. Scientists continue to use new techniques and equipment to look into cells to discover additional explanations for how they work.

Explanation:

Hope I helped!

4 0
3 years ago
Read 2 more answers
WILL MARK BRAINLYEST.
Illusion [34]

Is the answer three

Because they help the body absorb vitamins a, d, e, and k.

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Recalling Interactions among Organisms
kakasveta [241]
Bbvvcffcbgvvbbbbjjvvfccvvh
8 0
3 years ago
Read 2 more answers
Which of the following is true concerning sources of water pollution? a. Mine wastes and heavy metals become water pollution thr
liubo4ka [24]

The correct answer is that the following is true concerning sources of water pollution is option a. Mine wastes and heavy metals become water pollution through stormwater runoff.

Mine wastes and heavy metals become water pollution through stormwater runoff. As water contaminates by producing coppers, sulfate, sodium as the toxic elements contaminating the water. The chemicals are released from mining activities by contaminating soil, air, by causing pollution.

<h3>What are sources of water pollution?</h3>

The sources of water pollution are :

  • mining
  • industrial wastes.
  • marine dumping
  • burning of fossils
  • chemical fertilizers.

Hence concluded that water pollution can cause be caused by  Mine wastes and heavy metals becoming water pollution through stormwater runoff.

To know more about water pollution refer to the link :

brainly.com/question/25742259

4 0
3 years ago
Other questions:
  • Points A and B are the endpoints of an arc of a circle. Chords are drawn from the two endpoints to a third point, C, on the circ
    14·2 answers
  • A reform in the Second New Deal that helped millions of retired Americans with financial difficulties.
    6·2 answers
  • Which technology do environmental scientists use to photograph and report poaching activities
    9·2 answers
  • Which factors contribute to changing igneous and sedimentary rock into metamorphic rock
    7·2 answers
  • 30)
    8·2 answers
  • When two pea plants with Tt genotypes are cross-bred how many short (tt) plants will there most likely be in the new generation
    13·1 answer
  • How does using killed or weakened bacteria in an immunization help the body prevent infections?
    8·1 answer
  • PLS HELP!
    6·1 answer
  • Fleas are tiny insects that you might find on your dog. Fleas bite their skin and suck their blood causing them to itch while th
    13·1 answer
  • WHAT IS THE FUNCTION OF EACH OF THE FOLLOWING PARTS OF THE COMPOUND AND DISSECTING MICROSCOPE
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!