Answer: 
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
 
        
             
        
        
        
Answer:
It depends on the age of people using it at that time, but you can always try
Explanation:
 
        
                    
             
        
        
        
I believe that the purpose of business continuity planing session in an organization is to discuss how to return the organization to normal operations as quickly as possible after a data breach. Business continuity planning is the creation of a strategy through the recognition of threats and risks facing a company, with an aim of ensuring that personnel and assets are protected and in a position to function in the event of a disaster.
        
             
        
        
        
 
The geosphere has four subsystems called the lithosphere, hydrosphere, cryosphere, and atmosphere. Because these subsystems interact with each other and the biosphere, they work together to influence the climate, trigger geological processes, and affect life all over the Earth.