1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
6

Cellular differentiation progressively restricts cell fate because the unexpressed genes in the cell:

Biology
1 answer:
hichkok12 [17]3 years ago
6 0
The cellular differentiation is a biological process i which each cell<span> becomes increasingly specialized in form and function.</span><span>
Cellular differentiation progressively restricts cell fate because the unexpressed genes in the cell </span>become less densely packed and undergo irreversible repression
You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Can you use brainly for college work
Olenka [21]

Answer:

It depends on the age of people using it at that time, but you can always try

Explanation:

6 0
2 years ago
Read 2 more answers
Stone Mountain Park in Georgia has installed interlocking concrete pavers with areas of small stones. What makes this
Mrrafil [7]

Answer:

B

Explanation:

just took it

3 0
2 years ago
The purpose of a business continuity planning session in an organization is to ________.
Mazyrski [523]
I believe that the purpose of business continuity planing session in an organization is to discuss how to return the organization to normal operations as quickly as possible after a data breach. Business continuity planning is the creation of a strategy through the recognition of threats and risks facing a company, with an aim of ensuring that personnel and assets are protected and in a position to function in the event of a disaster.
5 0
3 years ago
How does the four subsystem of the Earth connectwitheach other?​
DiKsa [7]

The geosphere has four subsystems called the lithosphere, hydrosphere, cryosphere, and atmosphere. Because these subsystems interact with each other and the biosphere, they work together to influence the climate, trigger geological processes, and affect life all over the Earth.

3 0
3 years ago
Other questions:
  • What peptide would you expect to result from a 21-nucleotide-long DNA sequence that contains only the base adenine?
    10·1 answer
  • Why are there seasons
    15·2 answers
  • Which organelle is responsible for sorting and packaging proteins for storage and/or secretion from the cell?
    6·2 answers
  • Which of these words most closely matches the meaning of the word integrity in the sentence, "The ball of dough loses its struct
    8·1 answer
  • When a plant produces sugars and transports them during translocation, which main plant tissues are at work?
    15·2 answers
  • Assuming the stomata are open to the same degree, the rate of transpiration should _____ on a rainy day compared with a sunny da
    6·1 answer
  • What TWO factors do scientists track and monitor in all types of freshwater ecosystem?
    7·1 answer
  • How is the concept of homeostasis related to disease and aging provide examples?
    12·1 answer
  • Can somebody help me
    7·2 answers
  • Homeostasis is the regulation and maintenance of a stable internal environment of an organism to support life at the cellular le
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!