1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Julli [10]
3 years ago
10

In an experiment, researcher want to determeain if the _____variable cause changes in______ variable

Biology
1 answer:
asambeis [7]3 years ago
8 0
The answer is independent and dependent. I hope this helps! I'm sorry if I'm wrong.
You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which function is performed by Earth's magnetic field?
mafiozo [28]

Answer:

D. Ultraviolet rays from the sun are prevented from reaching Earth.

surface.

Explanation:

What little is known is that the Earth's magnetic field creates the so-called "magnetic shield" that provides protection against some other dangerous forms of radiation, namely cosmic rays and solar wind.

While there is no danger of losing the Earth's gravitational field, the Earth's magnetic field is declining faster than any other geophysical phenomenon. This continuous loss of the Earth's magnetic field, and the associated increase in harmful radiation, are beyond human control.

3 0
2 years ago
When oxygen is available,<br>cellular respiration takes place.​
nexus9112 [7]

Cellular respiration is a process that all living things use to convert glucose into energy. Autotrophs (like plants) produce glucose during photosynthesis. Heterotrophs (like humans) ingest other living things to obtain glucose. While the process can seem complex, this page takes you through the key elements of each part of cellular respiration.

Cellular respiration is a collection of three unique metabolic pathways: glycolysis, the citric acid cycle, and the electron transport chain. Glycolysis is an anaerobic process, while the other two pathways are aerobic. In order to move from glycolysis to the citric acid cycle, pyruvate molecules (the output of glycolysis) must be oxidized in a process called pyruvate oxidation.

Glycolysis

Glycolysis is the first pathway in cellular respiration. This pathway is anaerobic and takes place in the cytoplasm of the cell. This pathway breaks down 1 glucose molecule and produces 2 pyruvate molecules. There are two halves of glycolysis, with five steps in each half. The first half is known as the “energy requiring” steps. This half splits glucose, and uses up 2 ATP. If the concentration of pyruvate kinase is high enough, the second half of glycolysis can proceed. In the second half, the “energy releasing: steps, 4 molecules of ATP and 2 NADH are released. Glycolysis has a net gain of 2 ATP molecules and 2 NADH.

Some cells (e.g., mature mammalian red blood cells) cannot undergo aerobic respiration, so glycolysis is their only source of ATP. However, most cells undergo pyruvate oxidation and continue to the other pathways of cellular respiration.

Pyruvate Oxidation

In eukaryotes, pyruvate oxidation takes place in the mitochondria. Pyruvate oxidation can only happen if oxygen is available. In this process, the pyruvate created by glycolysis is oxidized. In this oxidation process, a carboxyl group is removed from pyruvate, creating acetyl groups, which compound with coenzyme A (CoA) to form acetyl CoA. This process also releases CO2.

Citric Acid Cycle

The citric acid cycle (also known as the Krebs cycle) is the second pathway in cellular respiration, and it also takes place in the mitochondria. The rate of the cycle is controlled by ATP concentration. When there is more ATP available, the rate slows down; when there is less ATP the rate increases. This pathway is a closed loop: the final step produces the compound needed for the first step.

The citric acid cycle is considered an aerobic pathway because the NADH and FADH2 it produces act as temporary electron storage compounds, transferring their electrons to the next pathway (electron transport chain), which uses atmospheric oxygen. Each turn of the citric acid cycle provides a net gain of CO2, 1 GTP or ATP, and 3 NADH and 1 FADH2.

Electron Transport Chain

Most ATP from glucose is generated in the electron transport chain. It is the only part of cellular respiration that directly consumes oxygen; however, in some prokaryotes, this is an anaerobic pathway. In eukaryotes, this pathway takes place in the inner mitochondrial membrane. In prokaryotes it occurs in the plasma membrane.

The electron transport chain is made up of 4 proteins along the membrane and a proton pump. A cofactor shuttles electrons between proteins I–III. If NAD is depleted, skip I: FADH2 starts on II. In chemiosmosis, a proton pump takes hydrogens from inside mitochondria to the outside; this spins the “motor” and the phosphate groups attach to that. The movement changes from ADP to ATP, creating 90% of ATP obtained from aerobic glucose catabolism.

7 0
3 years ago
Sorry, but I didn't read the directions for the section 4 discussion board. I already answered them before completing the notes.
USPshnik [31]
So do you have a question or?
5 0
3 years ago
During the movie, Mufasa talks to Simba about the kingdom. He says “Everything you see, exists together in a delicate balance… y
Anvisha [2.4K]

Answer:

Explanation:

Look i was supposed to play simba in the lion king so i know this. He says that because he is king so he has to make sure his kingdom is great or else people will turn on him. Hope this helps!!!

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which two structures produce energy that cells can use?
    13·1 answer
  • A mutation that results in a change in one amino acid is called a ___ mutation.
    15·1 answer
  • If the template strands reads 5’-GCCTGATCA-3’, what will be the new complementary strand?
    15·1 answer
  • In two or more complete sentences, describe the similarities between tornados and hurricanes.
    5·1 answer
  • What is the name of the model of maximum rate of population growth
    11·1 answer
  • Which causes natural selection to occur?
    6·1 answer
  • I have no idea how to solve these.
    9·1 answer
  • Your immune system consists of ____ that fight disease.
    7·2 answers
  • Give four examples of how either some or all of the organisms in this activity are related to one another based on how they are
    12·1 answer
  • Explain the relationship between small particle aerosols and areas od dense population​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!