1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetllana [295]
3 years ago
5

BIOLOGY-STARS-THANKS-BRAINIEST

Biology
1 answer:
vova2212 [387]3 years ago
3 0

D. POPS.

Your answer is D because pesticides have aldrin, chlordane, .... which are all POPS.

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Viruses can often lead to disease because they -(A)promote the growth of healthy cells.(B)increase the rate of cell division.(C)
MAXImum [283]
Cause cells to break open and die
3 0
3 years ago
Read 2 more answers
The________ are rules that apply to all living things​
Kisachek [45]

Answer:

characteristics of life?

Explanation:

3 0
2 years ago
For the growth curve to continue increasing, which of these must occur?
emmasim [6.3K]
Good health must occur.
7 0
2 years ago
Which of the following statements is true according to the food web shown above? A. Energy flows from consumers to decomposers a
omeli [17]
The answer is C. Producers make food which os then consumed then decomposers eat the remains.
3 0
2 years ago
Read 2 more answers
Other questions:
  • Heterozygous male guinea pigs with black, rough hair (BbRr) are crossed with heterozygous female guinea pigs with black, rough h
    6·1 answer
  • What happens when too much water enters an animal cell via osmosis
    12·1 answer
  • All life on earth exists in a region know as
    15·1 answer
  • Tables display data in row ad colums true or false
    7·2 answers
  • Which is not a factor that has been cited in support of intermediate sanctions?
    5·1 answer
  • Which of the following statements best describes the major difference between anaphase of mitosis and anaphase I of meiosis? In
    13·1 answer
  • If the concentration of sodium is greater outside a cell than inside the cell, which process could move sodium out of the cell?
    7·1 answer
  • Please help.. due tonight 10 points Will mark Brain
    9·1 answer
  • What is the process of VEGETATIVE PROPOGATION?? PLEASE HELP ME and Thank you so much!!
    12·1 answer
  • How are seeds different from spores?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!