1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
5

Forms when a cooler air mass displaces a warmer air mass and usually indicates drops in temperature, heavy rains, and sometimes

hail, thunder, or lightning.
Biology
1 answer:
jeka57 [31]3 years ago
6 0

Answer: Cold Front

Explanation: When cooler air mass pushes warm air mass it rise into the atmosphere since it is less dense forming clouds. During a cold front there is a relative decrease in the air temperature where the cooler air mass moved.

You might be interested in
Which of the following options describes a morula? THANKS FOR THE HELP!
stiv31 [10]

Answer:

A

Explanation:

4 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which answer choice BEST supports the idea that the Scientific Revolution questioned the established ways that Europeans underst
UNO [17]
The answer is d is the answer
3 0
3 years ago
Which describes step three of a muscle contraction?
olga55 [171]

Answer:

Actin and myosin are completely overlapped

5 0
3 years ago
Read 2 more answers
Need rn! worth 17 ~ 謝謝
babymother [125]

Answer:1) Chloroplast, mitochondrion and vacuole are the organelles

Explanation:  a leaf is a organ of a plant and is not found in cells. An enzyme creates chemical reactions in the body. the DNA is just the plan on how to build the cell and how to do certain cellular processes. therefore a chloroplast, mitochondria and vacuole are all organells. also the mitochondrion creates energy, a vacuole stores food and water and a chloroplast converts the suns energy into food

4 0
3 years ago
Other questions:
  • What is the role of a producer?
    11·2 answers
  • The most basic carbohydrates, simple sugars , are also known as monosaccharides. True or false?
    8·2 answers
  • Making toast in a toaster what is the energy before and after called?
    10·2 answers
  • What is the function of the endoskeleton in vertebrates?
    15·2 answers
  • Which sphere of Earth includes the continents and the ocean floor? Atmosphere Biosphere Geosphere Hydrosphere
    5·2 answers
  • Which of the following is an example of primary succession?
    8·1 answer
  • What happens during the process of glycolysis?
    8·2 answers
  • Help with this plz!
    9·2 answers
  • Fill in the blanks
    11·1 answer
  • Organisms who are capable of breeding because they are biologically and behaviorally compatible to produce viable, fertile offsp
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!