1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
13

2. Which two classes make up the majority of crustaceans?

Biology
1 answer:
Naddika [18.5K]3 years ago
7 0

Answer:here's 5:

Remipiedia

Cephalocardia

Branchiopoda

Maxillopoda

Mulacostraca

Explanation:

You might be interested in
Most cancer-causing air pollutants are found outdoors.<br> True or False?
astra-53 [7]

its actually false true is wrong

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
How are photosynthesis and cellular respiration related?
Mice21 [21]
The first statement is wrong because photosynthesis occur during day by plants, while respiration happens during day and night which are very related and they can be happened at the same time, in other hand photosynthesis cannot Accor in human cells because animal cells do not have chloroplasts which are using light energy to make glucose ,but in our cells or in animal cells we have mitochondria which break down the energy to make ATP....
for the second statement I'm not sure about that ....
I think that the third statement Is correct, because
the Cellular respiration make carbon dioxide + water + ATP then those would be then used by photosynthesis to make glucose and oxygen .



can I get brainlist pls?
5 0
3 years ago
Read 2 more answers
Please help me name each letter and match it to the definition.
lukranit [14]

Answer:

1. B. Medulla oblongata contains cardiac, respiratory, vasomotor and reflex centers.

2. A. Hypothalamus is the major regulator of ANS

3. D. Occipital lobe is the location of visual cortex.

4. F. Sensory areas are primary site responsible for perceiving cutaneous sensory sensations and proprioception.

5. E.Motor areas directs conscious motor movement

6. C. Cerebellum - coordinates movement by comparing intended movement with actual movement.

7. K. Corpus callosum allows communication between right & left cerebral hemispheres.

8. J. Frontal Lobe - Cognition, personality.

9. A. Hypothalamus - Contains hunger, thirst and thermoregulatory centers.

5 0
2 years ago
An old home is abandoned and the lawn is no longer cut. Eventually, small shrubs overgrow, then trees take over what was once a
musickatia [10]

Answer:

Explanation

A climax community (Figure below) is the end result of ecological succession. The climax community is a stable balance of all organisms in an ecosystem and will remain stable unless a disaster strikes. After the disaster, succession will start all over again.

6 0
3 years ago
Other questions:
  • What statement best describes an independent variable?
    9·2 answers
  • How do the HIV/Aids pandemic statistics vary around the world?
    7·1 answer
  • _________________ is a recessive genetic disorder that strikes young African-Americans and affects the hemoglobin in red blood c
    11·1 answer
  • Wilhich features of the ocean floor are found in the open ocean?
    13·1 answer
  • Which sentence is a complex sentence? A. Antony checked out one book from the library. B. Tim scored two points, and Alex scored
    14·2 answers
  • A solution that contains more solute than it would normally hold at the temp is sad to be
    5·1 answer
  • Which graph best shows the general effect that differences in elevation above sea level have on the average annual temperature?
    11·1 answer
  • In snow-bound, where does the speakers sense of hope come from?
    11·1 answer
  • How are the circulatory systems in animals and plants alike?
    12·1 answer
  • How to sold equation with periodic table of elements?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!