1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
3 years ago
6

How can we use rocks to determine how an area used to look in the past?

Biology
1 answer:
Kamila [148]3 years ago
8 0
Through looking at layers of rock you can tell what kind of things transpired. If you find Fish fossils you can assume that at one point in time, there may have been a body of water of some sort. if you find certain plants, you can deduce that there was a forest or a grassy pasture. Or if there are variations in the layer you may be able to tell what kind of soil was there at one point in time, or maybe if there is volcanic rock, you could rightly assume there was a volcanic eruption at some point.
You might be interested in
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
What is the main energy providing molecules in living things
ivann1987 [24]
ATP is the main energy-providing molecule in living organisms.  
6 0
3 years ago
Which statement describes the blood type of a person with the alleles IAIB?
kobusy [5.1K]
It is type A because A and B exhibit incomplete dominance
4 0
3 years ago
Read 2 more answers
Why do you think air pressure is greatest at the lowest part of the atmosphere?
Alex777 [14]

Answer:

At sea level, air pressure is greatest because it is caused by the weight of the entire column of atmosphere at that altitude over that location. As altitude increases, the column of atmosphere gets shorter, and so less weight is pressing down at a given altitude, so atmospheric pressure is reduced.

4 0
3 years ago
Which of the following environmental justice policies would the Environmental Protection Agency be least interested in
NISA [10]

Answer: Your answer is indeed <u>A. Fair treatment.</u>

Hope this helps!

4 0
2 years ago
Other questions:
  • Where does most energy that is provided to the muscles come from
    6·1 answer
  • What is the limiting factor for the growth of trees in the tundra? question 1 options:
    5·1 answer
  • Organisms that can produce their own food from an external source of energy without having to eat other organisms are called
    12·1 answer
  • What is the smallest part of a cell?
    13·1 answer
  • Why on earth am I so tired and void of energy although I slept well
    10·2 answers
  • TIME REMAINING
    12·2 answers
  • Human activity has increased the amount of carbon dioxide on the atmosphere yes. The carbon dioxide that only remains in the air
    13·1 answer
  • Jellyfish, corals, and hydras are examples of which of the following?
    15·1 answer
  • What structure pull the chromosomes apart
    13·2 answers
  • C. In which situation is the paramecium in danger of swelling up and bursting?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!