1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
5

100 POINTS PLEASE HELP WILL MARK BRAINLIEST Piecewise Functions Project

Mathematics
2 answers:
Semmy [17]3 years ago
5 0

You should just search that up on google and u would find it.

Anvisha [2.4K]3 years ago
5 0

Answer:

no today mortal fool

Anyways r u coming to the party??????

The high school one

Step-by-step explanation:

You might be interested in
What is i^32? <br> A.1<br> B. -1<br> C.-i <br> D. i
drek231 [11]
The answer to this question "What is i^32?" is A.1
8 0
3 years ago
What decimal is equivalent to 27/32
PilotLPTM [1.2K]

Answer:

0.8438

0.8438 is a decimal and 84.38/100 or 84.38% is the percentage for 27/32.

Step-by-step explanation:

3 0
2 years ago
Read 2 more answers
Maryann is testing the effectiveness of a new acne medication. There are 100 people with acne in the study. Fifty-five patients
Nata [24]

58% is the correct answer

4 0
3 years ago
Solve these equations.<br> |x-7|=x-7
Cloud [144]

Answer:

x ≥ 7

Step-by-step explanation:

|x - 7| = x - 7

A. For each absolute, find the intervals

x - 7 ≥ 0     x - 7 < 0

     x ≥ 7           x < 7

If x ≥ 7, |x - 7| = x - 7 > 0.

If x < 7, |x - 7| = x - 7 < 0. No solution.

B. Solve for x < 7

Rewrite |x - 7| = x - 7 as

+(x - 7) = x - 7

      x - 7 = x - 7

-x + 14 = x

        14 = 2x

          x = 7

7 ≮7. No solution

C. Solve for x ≥ 7

Rewrite |x - 7| = x - 7 as

+(x - 7) = x - 7

      x - 7 = x - 7

True for all x.

D. Merge overlapping intervals

No solution or x ≥ 7

⇒ x ≥ 7

The diagram below shows that the graphs of y = |x - 7| (blue) and of y = x - 7 (dashed red) coincide only when x ≥ 7.

6 0
3 years ago
3. (03.06)
lisabon 2012 [21]

Answer:

work is shown and pictured

5 0
3 years ago
Other questions:
  • How to find domain and range on functions
    8·1 answer
  • 14 students in neils class play basketball. 35 percent of the students in his class play basketball. How many total students are
    14·2 answers
  • Write an expression that is equivalent to three over four(5z + 16).A: 15 over fourz + 16B:15 over fourz + 12C: three over fourz
    5·1 answer
  • A common concern for students (and teachers) is the assignment of grades for essays or term papers. Because there are no absolut
    12·1 answer
  • In the scale used on a blueprint,1/4 inch represents 2 feet.On the blueprint,what is the length of a room with an actual length
    13·2 answers
  • 25. A punter kicks a football upward with an initial speed of 48 feet per second. After how many seconds does the ball hit the g
    8·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Suppose the expression was (12 - 3)². Would you still simplify 3² first? Explain.
    11·2 answers
  • Kali is very organized, very creative, and likes to come up with different slogans for commercials. Which career pathway would b
    9·2 answers
  • in the computer lab, there are 1 PC every 5 Mac computers. if the computer lab has a total of 24 computers, how many are Mac?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!