1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
14

____________ is a hormone produced by the stomach. its levels rise before and fall after meals, which may provide a short-term s

ignal to eat.
Biology
1 answer:
Irina-Kira [14]3 years ago
5 0
I believe it is ph level,but I don't know for sure.
You might be interested in
Compared to farms of 100 years ago modern agribusinesses need
aliya0001 [1]

fewer workers.

Hope this helps!



5 0
3 years ago
Manu wanted to verify if fertilizers help plants to grow well. He took a potted plant, mixed fertilizer with the soil and took g
eimsori [14]

Answer: He didn’t grow a plant without fertilizer.

Explanation: Manu has nothing to compare his plant to. Meaning, he cannot prove that fertilizers help plants grow. He needs to grow a plant with and without fertilizer.

8 0
3 years ago
Answer this question. What are the main differences between bacteria and archaea?
Arisa [49]

Answer:

they are two different oranisms

Explanation:

and they share azotobacter , bacteroids

7 0
3 years ago
Ecologists conduct population studies to understand population dynamics by investigating how the ______________ increases or dec
Lelechka [254]

Population study in ecology is a broad topic to be studied, in order to answer this question we must know that .......

<h3>Population </h3>

A population, in Ecology, can be defined as a set of individuals of the same species that live in a given area in a given period of time. Individuals in one population are more likely to interbreed with each other than with organisms in another population of the same species.

<h3>Population dynamics</h3><h3> </h3>

Population dynamics is the study of how and why populations change in size and structure over time. Important factors in population dynamics include rates of reproduction, death and migration.

With this information, we can say that" Ecologists conduct population studies to understand population dynamics by investigating how the <u>number of individuals</u> increases or decreases over time.

<u />

<u>We can conclude that these studies in </u><u>Population dynamics </u><u>are of great relevance to visualize the characteristics of </u><u>populations</u><u>.</u>

<u />

Learn more about species  in brainly.com/question/13259455?referrer=searchResults

3 0
3 years ago
How are genes responsible for cellular differences?
Shkiper50 [21]
<span>There are many different types of cells in multicellular organisms. Of course, depending upon the type of organism the overall number and different types will vary. In general though for mammals the broad classifications would include epithelial, endothelial, connective, smooth muscle, striated muscle, cardiac muscle, neuronal, glial, and many others. They can also be referred to based on their own embryonic development into 3 broad classes endodermal, epidermal, and mesodermal.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
6 0
3 years ago
Other questions:
  • How can a person guard against a decrease in heart and lung function?
    9·2 answers
  • What might be a natural reason for low survival rates of jaguar cubs
    6·2 answers
  • During metaphase of meiosis I, homologous chromosomes and the alleles they possess are organized for distribution to different g
    11·1 answer
  • How long is a term for a US senator?
    15·2 answers
  • The average adult has approximately ___________ of blood in his or her vascular system.
    6·1 answer
  • The letter X in the process represents
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In coccidioidomycosis, _______ containing many endospores form in the lungs.
    13·1 answer
  • Without energy, molecules tend to want to move from
    12·1 answer
  • Describe the differences between a sea turtle and a desert tortoise. Explain the link between natural selection of these traits
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!