1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
4 years ago
13

After surgery for bilateral adrenalectomy, the client is kept on bed rest for several days. which exercise will be most effectiv

e for preparing a client for ambulation after a period of bed rest?
Biology
1 answer:
AnnyKZ [126]4 years ago
4 0

For walking, a group of four muscles, known as Quadriceps muscles are the most important. A complete bed rest for a longer period of time causes the reduction in the flexibility of the quadriceps. So, in order to prepare a person for ambulating after a long bed rest, the nurse should focus to restore the flexibility in the quadriceps. This can be done by alternating flexing and relaxing the quadriceps. This exercise would help in reviving the strength of the quadriceps.

You might be interested in
6. Which of the following statements best describes one way that the Moon is different from
scoray [572]

Answer:

b. The Moon has no gravity.

5 0
3 years ago
Read 2 more answers
N what area do you feel you made your biggest improvements?
Marina86 [1]

This is supposed to be a personal opinion answer.

5 0
3 years ago
How do I file a complaint on brainly? I'm trying to ask a question on biology and it says Im using a phrase that hurts their fee
Sophie [7]

Answer:

i know it gets really anoying

6 0
3 years ago
The oil and vinegar in your salad dressing remain separate from one another due to the _____ properties of the oil
Bingel [31]
The answer is: hydrophobic 
3 0
3 years ago
What will happen to the food web if all primary consumers became extinct?
kap26 [50]
The producers would grow more food to be eaten but the secondary/tertiary etc consumers would have nothing to eat and so numbers would drop on that side
4 0
4 years ago
Other questions:
  • If a long tail is a dominant characteristic, in which case is the characteristic of a long tail definitely
    5·2 answers
  • What are the most important processes in the cycling of oxygen in and out of the atmosphere
    6·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • List two factors that determine where an organism lives in an aquatic ecosystem
    9·1 answer
  • What does varying locally mean?
    7·2 answers
  • A secondary consumer cannot survive, if there are no plants on the earth because ​
    9·1 answer
  • Soil is a mixture of _______. a. solids b. solids, liquids, and gases c. solids and liquids d. solids and gases
    11·2 answers
  • Which of the following is carried out by vesicles?
    11·1 answer
  • Which of the following best describes a characteristic of DNA that makes it useful as hereditary material?
    13·2 answers
  • Which of the following cannot be used to produce electricity?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!