<span>C.The amount of light </span>
Meiosis<span> has two rounds of genetic separation and cellular division while </span>mitosis <span>only has one of each. In </span>meiosis<span> homologous chromosomes separate leading to daughter cells that are not genetically identical. </span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The proteins exhibit four levels of organization:
1. Primary structure: It refers to a sequence of amino acids join together by the peptide bonds to produce a polypeptide chain.
2. Secondary structure: It is a localized twisting of the polypeptide chain by producing a hydrogen bond. Two types are formed, that is, the alpha helix and beta pleated sheet.
3. Tertiary structure: It refers to the three-dimensional composition of a polypeptide chain. The folding is not regular as it is in secondary composition. It produces ionic bonds, hydrophobic interactions, disulfide bond, and hydrogen bond amongst the polypeptide chains.
4. Quaternary structure: It comprises an amalgamation of two or more polypeptide chains that functions as a single functional unit. The bonds are identical as in tertiary composition.
Thus, the levels of secondary, tertiary, and quaternary protein structure would get affected if all the hydrogen bonding associations were inhibited.
