1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
3 years ago
11

Please answer right im failing this subject and ive cried over it for 2 hours jskdfbf

Biology
1 answer:
Vlad1618 [11]3 years ago
5 0

Answer:

C. Absorbency, because all soil does not absorb water, such as sand. The other components such as clay, silt, and organic matter are much smaller and absorb much more.

You might be interested in
Please help with this biology question!
mario62 [17]

Answer:

mito

Explanation:

5 0
3 years ago
Read 2 more answers
How do photoautotrophs make energy?
Katena32 [7]

Answer:

The right answer is D

Explanation:

They use carbon dioxide, water and sunlight to make carbohydrates. And the oxygen is just a byproduct. No real organic molecules are needed before.

8 0
3 years ago
What are the tool used to look at the basic structure
densk [106]

Answer:

Documentation,link section ,definition section ,main function ,etc

5 0
3 years ago
Are zombies biotic or abiotic?
kaheart [24]
Abiotic because biotic is living. So abiotic is the opposite.
7 0
3 years ago
Read 2 more answers
How are photosynthesis and cellular respiration related
iragen [17]
Photosynthesis and cellular respiration are opposites
8 0
3 years ago
Read 2 more answers
Other questions:
  • Based on cell theory, why is a virus considered non-living? A) A virus does not have a nucleus. B) A virus does not contain gene
    5·2 answers
  • Why its important that skull joints cannot move
    9·1 answer
  • Which would most likely cause a forced migration due to loss of habitat?
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A prokaryote has a Gram-negative cell wall and a basic cell membrane, is spiral shaped, and has two polar flagellA. Referring to
    10·1 answer
  • The researcher determines that the S value (number of species at equilibrium) for the island closer to the mainland is _________
    8·1 answer
  • What is the effect of mutated GLMN Gene on the human body?
    15·1 answer
  • How long does it take blood to circulate through the body
    13·1 answer
  • The largest ape that walked on Earth was a prehistoric
    7·1 answer
  • DNA replication is said to be………. Because each strand acts as a template to construct the other half of the molecule
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!