1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
2 years ago
8

¿En cuál de los siguientes alimentos es posible encontrar una mayor cantidad de proteínas? A. Pera. B. Agua. C. Carne. D. Manteq

uilla.
Biology
1 answer:
andre [41]2 years ago
8 0

Answer:

C. Carne  

Explanation:

La proteínas representan un macronutriente (al igual que lípidos y carbohidratos) fundamental para el organismo. El consumo de proteínas es clave en la dieta porque el organismo utiliza estas moléculas (o sus bloques de construcción, los aminoácidos) para construir diferentes estructuras celulares y llevar a cabo diversos procesos vitales tales como, por ejemplo, reparar y desarrollar tejidos, funciones endócrinas, defender al organismo de agentes patógenos infecciosos, etc. En un adulto, la ingesta diaria de proteína debe rondar del 15 al 35% del total de las calorías consumidas al día, lo cual representa aproximadamente de 0.8 a 1.3 gramos por cada kilogramo de peso corporal. La carne es un alimento que aporta un gran contenido de proteínas y también es fuente de vitaminas y minerales (es decir, micronutrientes). Otros alimentos ricos en proteínas incluyen, por ejemplo, huevos, leche, legumbres (arvejas, garbanzos, lentejas) y la soja.

You might be interested in
The process that uses oxygen to create to create ATP from food molecules is
Alecsey [184]
The Answer IS AEROBIC RESPIRARTION because it’s The breakdown of food to create energy in the presence of oxygen.
6 0
2 years ago
Cells identical to original cell is it mitosis or meiosis
dimulka [17.4K]

Mitosis

Explanation ~ Mitosis creates two daughter cells each having the same number and kind of chromosomes as the parent nucleus

6 0
2 years ago
Calcium iron vitamin c and vitamin d in which of these is organic substances​
Elodia [21]

Answer:

vitamin C and vitamin d

Explanation:

because if the digested first only no vitamin it's supply to our body

examples like eggs

8 0
2 years ago
Question involving the equations for Hardy Weinberg equilibrium (A^2+2Aa+a^2=1, A+a=1)
Alinara [238K]

Answer:

Frequency of dominant allele is 0.9029

Explanation:

Total number of organisms = 12,845

Number of organisms representing dominant trait = 11,596. These organisms might have heterozygotes with one dominant allele and one recessive allele.

Hence, Number of organisms with recessive alleles = 12845 – 11596 = 1249

Frequency of recessive allele (q) = 1249/12845 = 0.0971

Frequency of dominant allele (p) = 1- q = 1-  0.0971 = 0.9029

5 0
3 years ago
Which organisms can cause contagious deceases?
jekas [21]
Protozoans, bacteria, fungi... viruses are not organisms
5 0
3 years ago
Other questions:
  • In the peppered moth scenarios what is the variation? And the selection?
    11·1 answer
  • does anyone know how to solve the chargaffs rule it's asking me for a chicken,human,dog, and fish please I need help
    7·1 answer
  • What's the difference between non-living and dead things?
    6·2 answers
  • How do aquatic factors affect the distribution of aquatic life. Include biotic and abiotic factors. Please help. Thanks
    13·1 answer
  • Which of the following ecological roles is/are played by at least some fungi? Select all that apply.A) AutotrophyB) PredationC)
    8·1 answer
  • Which of the following tissues, cells, or structures in flowering plants is a part of the sporophyte generation and therefore di
    10·1 answer
  • What molecules are carbon atoms<br> in after the chemical change?
    10·1 answer
  • When stomata are open and a plant is transpiring normally, how does water move from the soil into the root xylem? Select all tha
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The united states , canada , japan , and england are all examples of ?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!