1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
14

The fatty protective covering for neurons is _____.

Biology
1 answer:
IgorC [24]3 years ago
5 0
Hi.
Your answer would be myelin sheath.
You might be interested in
10 points
777dan777 [17]
The second answer. The atmosphere blocks of absorbs them.
3 0
3 years ago
In a particular population, over the course of several dozen generations, an adenine was replaced by a guanine at a particular n
fgiga [73]

Answer:

Mutation

Explanation:

A Mutation alters the genetic message carried by that gene as there are permanent changes in the nucleotide sequence of DNA or a DNA gene.

This can occur by base pairs substitution, deletion or insertion

5 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What substances does lichen and moss produce that will break down rock?
Gnoma [55]
Acid I think is the correct answer
7 0
2 years ago
Goodmorning, can someone please help me figure this out? Thanks
siniylev [52]

Answer:

Vacuole.

Hope this helps!

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Sickle cell anemia is a homozygous recessive disorder. This means, in order to have sickle cell anemia, you must have two copies
    5·2 answers
  • What is the meaning of testoterone
    12·1 answer
  • What would be the outcome of a unicellular arganism that cannot maintain homeostasis
    8·1 answer
  • Which adaptation helps polar bears maintain a constant internal temperature in cold weather?
    8·1 answer
  • What is the term for the breakdown of glucose in the absence of oxygen?
    12·1 answer
  • All eukaryotes in the Eukarya domain are multicellular.<br> Question 2 options:<br> True<br> False
    9·1 answer
  • How does the author organize the text or ideas in the article check all that apply a by using paragraphs to focus on ideas be by
    13·2 answers
  • Elijah wanted to learn more about the growth pattern of bacteria, so he performed the following experiment.
    14·1 answer
  • What is the basic unit of organization of all living things?
    12·1 answer
  • A student is investigating how substrate concentration affects the rate of anenzyme-catalyzed reaction. Which ​threevariables​ s
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!