1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
9

Name some of the organelles found in atypical animal cell

Biology
1 answer:
TiliK225 [7]3 years ago
7 0
Nucleus, mitochondria, cell membrane, ribosomes, lysosomes.
You might be interested in
As seen in the venn diagram, meiosis is responsible for the production of haploid gametes. somatic or body cells are 2n cells. t
Simora [160]
This change in chromosome number is the result of B. Fertilization. Both of the individual gametes from the male and female combine together to produce a zygote or developing offspring that is diploid in most cases, and possess both sets of genetic content or chromosomal information, one from each parent.
8 0
3 years ago
Read 2 more answers
Which climate condition generally results from both an increase in distance from the equator and an increase in elevation above
Tpy6a [65]
The answer would be: <span>a. cooler temperatures 

</span>Increase in distance from the equator will reduce the amount of sunlight received, which will make the area have a cooler temperature. I<span>ncrease in elevation above sea level should make the air pressure lower as there is less air above the area.</span>
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What strengthens and helps to maintain the fluid nature of a cell regardless of temperature?
Amanda [17]

Cholesterol in Cell membrane  strengthens and helps to maintain the fluid nature of a cell regardless of temperature

<u>Explanation:</u>

All organisms are made up of one or more cells. Each cell is protected or differentiated by a covering called as the cell membrane. Phospholipids are the basic structure of the cell membrane. Cholesterol prevents the loss of fluid from phospholipids.  

Cell membrane has a lipid layer and cholesterol which is placed between the phospholipids to maintain the fluid nature of the cell under different temperature. Cholesterol prevents the cell from solidifying and helps maintain the fluid. Cholesterol actually acts as a buffer between different temperatures.

3 0
3 years ago
How eukaryotes are more complex than prokaryotes.
Rasek [7]

Explanation:

Eukaryotic cells are more complex than prokaryotes, and the DNA is linear and found within a nucleus. Eukaryotic cells boast their own personal "power plants", called mitochondria.

hope it helps!

7 0
3 years ago
Other questions:
  • Formation of peptide bonds between amino acids to build a polypeptide would be called
    10·1 answer
  • Why does the rotation of earth require people to establish time zones?
    5·2 answers
  • Pasteurization is used to heat milk and remove any disease-causing organisms. It does not change the nutritional value or taste
    14·1 answer
  • Scientists find the fossilized remains of a dinosaur in the bottom rock layers of a research site. They find the fossil of a mam
    7·1 answer
  • Describe 3 observation an astronaut might make while viewing russia at night?
    10·1 answer
  • Identify two ways in which you
    8·2 answers
  • What is a grade AA egg?
    10·2 answers
  • What is the product P?<br> A) Energy <br> B) Glucose <br> C) Hydrogen <br> D) Nitrogen
    15·2 answers
  • Mention the non-living and living characteristics of viruses?
    12·2 answers
  • Does anyone know what the answer is
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!