1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
6

How do waves and currents affect beaches overtime?

Biology
1 answer:
Westkost [7]3 years ago
7 0
The cause the shifting of sand into different parts 
You might be interested in
Astronauts and backpackers often bring dehydrated food. what do you think dehydrated food is?
ad-work [718]
A substance that can be used or prepared for use as food
3 0
3 years ago
Nucleic Acids make up DNA. DNA, in turn, is used as a blueprint to make
natali 33 [55]

Answer:

I believe its RNA

Explanation:

RNA is the new copy of DNA

4 0
3 years ago
What is molten rock outside Earth from a volcanic eruption called?
KatRina [158]
It is called magma when in is under the earths crust, but above the surface it is called lava. So the answer would be "B."
5 0
4 years ago
Read 2 more answers
The cell theory apply to
gayaneshka [121]
The Cell Theory Applies to ⬇

✅Multicellular Organisms✅

✅Plants & Animals✅

✅Bacteria✅
8 0
3 years ago
What happens if cell cycle regulator don’t function properly
Dvinal [7]

Internal regulators allow the cell cycle to proceed only when certain processes have happened inside the cell. ... Cancer cells do not respond to the signals that regulate the growth of most cells. As a result, they divide uncontrollably and form masses of cells called tumors that can damage the surrounding tissues.

3 0
3 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Someone pleas help :(
    8·2 answers
  • If a human child had a mother with dyed pink hair and a father who was missing a finger from an accident would the child inherit
    13·2 answers
  • Which of the following are limits of reductionism when applied to living systems?
    5·1 answer
  • Most organisms (including you) break down organic compounds to obtain energy and nutritional building blocks. In contrast, chemo
    12·1 answer
  • Which of these is not currently a source of usable energy?
    13·2 answers
  • Which of the following is another name for the columns on the periodic table?
    15·2 answers
  • Help!! does anyone know the answer??
    12·2 answers
  • Why is starch an important molecule in gravitropism?
    10·2 answers
  • Examine the Lucy (Australopithecus afarensis) skeleton. Describe at least two postcranial (below the head) traits that indicate
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!