1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Finger [1]
3 years ago
14

A light is traveling straight up out of the ocean, then moves out of the air. how do you expect the movement of the light wave t

o change?
Biology
1 answer:
navik [9.2K]3 years ago
8 0
If a light is traveling straight up out of the ocean, then moves out of the air it will become less refracted because it is moving to a far less-dense medium, meaning the image will not be distorted. 
You might be interested in
Short answer question::<br><br> A rock formation that soil comes from is called ___
choli [55]
It’s called Igneous .......................
3 0
3 years ago
Read 2 more answers
Organic matter in soil is also called _____.
9966 [12]

Answer:

The correct answer would be humus.

Humus is the organic material of the soil formed by the decomposition of the dead plants and animals. It is thick and dark in color (brown or black) and can also be produced by the process of composting.

It is very for the soil as it adds moisture to the soil, enhances the structure of the soil which increases the aeration and drainage.

It favors the growth of organisms (such as earthworm) helpful for the growth of plants and adds lots of nutrients to the soil, specially nitrogen.

In contrast, loam is a type of soil which is composed of silt, sand, and clay in 40-40-20 ratio. Regolith referred to the superficial layer covering the solid rocks or bedrock. It is formed by the accumulation of soil, dust, broken rocks etc on the bedrock.

Lastly, talus referred to the slope which is formed by deposition of shattered rock debris at the base of a cliff.

7 0
2 years ago
Read 2 more answers
How do animals get nitrogen
7nadin3 [17]

Answer:

A they break down glucose moleculws

5 0
3 years ago
Read 2 more answers
Describe the similarities and differences between the cheek cell wet mount and dental plaque wet mount
Arada [10]

Answer:

Cells from the cheek are a type of epithelial cell, similar to skin. ... They can be seen faintly even at 40x (scanning power), but the most dramatic images are at 400x where the nucleus is clearly visible as a dark spot in the center of the cell.

Explanation:

5 0
2 years ago
Which statement is not correct about the antibodies?
Marrrta [24]

Answer:

b. They are produced by memory B cells

Explanation:

The rapid cell division in activated B cells is followed by the differentiation of daughter cells into the plasma cells. The plasma cells are the precursor for antibodies and memory B cells. The antibodies kill the antigens while memory B cells are long-lived cells.  

Hence, antibodies are not produced by memory B cells but by plasma cells.

5 0
3 years ago
Other questions:
  • How will adding lemon juice affect a soaps ph
    15·2 answers
  • Choose the best answer that describes what is happening during the process of interphase.
    7·1 answer
  • Which of the following functions has a requirement for thiamin? Blood coagulation Formation of red blood cells Energy release fr
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which is the best example of an abiotic factor in a ecosystem? A. Planting new trees B. Hunting C. Building a dam D. Harvesting
    14·1 answer
  • Which is not a type of crystal system?
    8·1 answer
  • If the population of hawks in this area increases, their prey populations might decrease. Later, with fewer prey, the hawk popul
    10·1 answer
  • What are some nonlethal solutions to the problem of wolves attacking cattle and sheep?
    13·2 answers
  • which classification level is broader than the kingdom level; which branch of biology is concerned with the naming and classifyi
    12·1 answer
  • a dna strand is aacgtaacg . what will be the sequence of the mrna? uug ugc aacgtaacg atgcatgc aacgtaacg
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!