1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
neonofarm [45]
3 years ago
10

If the population of hawks in this area increases, their prey populations might decrease. Later, with fewer prey, the hawk popul

ation might decrease. The prey populations might then increase. This is an example of
Biology
1 answer:
Vanyuwa [196]3 years ago
3 0

Answer:

This question lacks options, the options are:

1. an ecosystem completely out of balance

2. how ecosystems maintain stability over time

3. interaction between biotic and abiotic factors within an ecosystem

4. ecological succession

The answer is 2

Explanation:

An ecosystem comprises of biotic organisms, abiotic substances etc. that interact with one another. The biotic components of an ecosystem are known to feed on one another in order to obtain energy. However, stability of an ecosystem must be maintained between predators and prey or else there will be extinction of many species of organisms.

One way balance in an ecosystem is maintained over time is by the increase and decrease in population of predators and preys in an ecosystem. For example, If the population of hawks (predator) in an area increases, their prey populations might decrease because there will be less predation.

Also, at a later time, when there is a fewer population of prey, the hawk population might decrease because there is less food to eat. The prey populations might then increase.

You might be interested in
Which structure is ouside the nucleus of a cell and contains DNA?​
Black_prince [1.1K]

Answer:

The nucleus is an organelle found in eukaryotic cells.

Explanation:

8 0
3 years ago
What releases toxins that can kill marine life?
strojnjashka [21]
The toxins are the substances which decreases the conc. of oxygen in wzater and increase toxicity
6 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Cheese and yogurt are products of which of the following processes?
nadya68 [22]

Answer:

Lactic acid fermentation

Explanation:

8 0
2 years ago
Read 2 more answers
Proteins are dynamic molecules that are capable of ________ motion that can have important functional relevance. The existence o
Inessa05 [86]

Answer:

intrinsic

Explanation:

Proteins are dynamic molecules that are capable of INTRINSIC motion that can have important functional relevance. The existence of this type of motion has suggested that enzymes are capable - even in the absence of substrate - of many of the same movements that can be detected during their catalytic cycle

6 0
3 years ago
Other questions:
  • "emerging adults who manage their sleep patterns, monitor their food intake, and maintain a health weight are using ____________
    10·1 answer
  • How do scientists know about the liquid outer core? How do scientists know that the outer core is liquid?
    7·1 answer
  • Hormones that bind to plasma proteins ________.
    14·1 answer
  • What is jin wang's response to finding wei-chen and amelia locked in the biology lab closet?
    11·1 answer
  • Which molecule brings amino acids to the ribosomes during protein synthesis?
    13·1 answer
  • Describe why it is essential for dna to replicate prior to cell division
    5·1 answer
  • Need help on all of the blanks please
    12·1 answer
  • Think back to theThe carbon cycle simulation how does carbon enter ocean water?
    9·1 answer
  • Why mesophyll cell is considered as parenchyma cell​
    9·1 answer
  • What is april?? co.me he.re qvuutrksra​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!