The correct answer is option A,
Reason - The density of outer core is less than the density of inner core density and thus among all the given options the more probable answer is option A
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The right answer is C. thermoregulation and hormone transport.
The cardiovascular system has the function of distributing the blood to the organs.
Blood is a red and slightly viscous liquid that circulates in the blood vessels, propelled by the heart, is essential to the maintenance of life. It transports nutrients, oxygen and hormones to the cells of the body, and rids them of their waste.
Blood circulation helps control body temperature and regulates the volume of certain liquids in the tissues. In addition, the blood carries white blood cells, which defend our body against germs.
UNVY-A is supoorted by other things u dint need more chemicals
Explanation:
2 females can have a baby with the same Gene's by mating with the same Male. especially if the females are sisters.