1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
2 years ago
15

Which is the best way to determine a species population in an area?

Biology
2 answers:
Blizzard [7]2 years ago
7 0

i think the answer is c

Marina CMI [18]2 years ago
5 0

Answer:

A.- Subtract those leaving the area from those in or arriving at the area

Explanation:

As in demography, a total population of a specie is determined by the total of the individuals of a specie, less the exit or death of an individuals of a that specie, in a given time

You might be interested in
The lower mantle has an average density of 5.5 g/cm³ which of the following could be density of the outer core?
ira [324]

The correct answer is option A,

Reason - The density of outer core is less than the density of inner core density and thus among all the given options the more probable answer is option A


6 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
How does the cardiovascular system help the body maintain homeostasis?
shtirl [24]

The right answer is C. thermoregulation and hormone transport.

The cardiovascular system has the function of distributing the blood to the organs.

Blood is a red and slightly viscous liquid that circulates in the blood vessels, propelled by the heart, is essential to the maintenance of life. It transports nutrients, oxygen and hormones to the cells of the body, and rids them of their waste.

Blood circulation helps control body temperature and regulates the volume of certain liquids in the tissues. In addition, the blood carries white blood cells, which defend our body against germs.

3 0
3 years ago
Read 2 more answers
In low-nitrogen conditions UCYN-A participates ina mutualistic symbiotic relationship with other organisms in the microbial mat.
Lerok [7]
UNVY-A is supoorted by other things u dint need more chemicals

5 0
2 years ago
Read 2 more answers
How can two females have a baby with the same genes
Anika [276]

Explanation:

2 females can have a baby with the same Gene's by mating with the same Male. especially if the females are sisters.

5 0
3 years ago
Other questions:
  • Identify the characteristics of Aphotic!!<br> HELPPPP
    5·1 answer
  • Specifically how long did each eon last?
    9·1 answer
  • Does the ANIMAL CELL have FLAGELLA / CILIA?<br> A. Yes<br> B. No
    9·1 answer
  • Helpnsjsjsjsjsjdjdjjdkdxkkx
    8·1 answer
  • Which of the follling is not true about detuals view?
    8·1 answer
  • Difference between DNA and Chromosome
    8·1 answer
  • How does natural selection lead to evolution?
    10·1 answer
  • Research shows that the four predominant emotions in counseling students are the same core emotions that are typically part of t
    13·1 answer
  • The area of biology devoted to the study of fungi is known as?
    14·1 answer
  • EXPLAIN How have advancements in computer technology most directly influenced our
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!