1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
3 years ago
12

Spanish scientist observes that salmon produce more eggs when grown in a warmer aquariums he asked his colleagues in the United

States to conduct the same experiment using the same aquarium equipment should he expect the results to be similar
Biology
1 answer:
Luba_88 [7]3 years ago
4 0
No. The fish where he lives could be adapted to the warmer waters of a southern state/country.
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Describe 1 attribute of a polar climate
leva [86]

Answer:

long cold winters, with annual temperatures mostly below freezing.

6 0
2 years ago
Read 2 more answers
Which of the following statements about blood is false?
SCORPION-xisa [38]

Answer:

B) The normal pH of blood is 6.8 to 7.0.

Explanation:

The blood pH under normal health conditions is between 7.35 and 7.45. Below this range, blood pH is considered more acidic than normal, and it may indicate that the body is eliminating a lower amount of CO{2} than normal, or that there is a decrease in the concentration of HCO{3-} or accumulation of acid in the blood due to poisoning or disease.

3 0
3 years ago
Which of the following CANNOT occur during a chemical reaction
xz_007 [3.2K]

Answer: No atoms can be created and no atoms can be destroyed.

(don't know if thats what you were looking for)

Explanation:

3 0
3 years ago
Read 2 more answers
From left to right what are the three components of the nucleotide shown in this model?
kiruha [24]
Nitrogenous base, sugar and phosphate
4 0
3 years ago
Other questions:
  • There are two different food chains in this example: 1. Spinach --&gt; goat --&gt; human --&gt; tiger 2. Spinach --&gt; goat --&
    13·2 answers
  • How can the extinction of a single species affect how the ecosystem functions? give an example?
    14·1 answer
  • If life was found on another planet, what would it need if it were similar to life on earth
    5·1 answer
  • The father of a neonate diagnosed with gastroschisis tells the nurse that his wife had planned on breastfeeding the neonate. whi
    15·2 answers
  • What vascular plant tissue is made of dead cells?
    8·1 answer
  • Which organelle is responsible for manufacturing proteins? vacuoles lysosomes golgi apparatus ribosomes
    7·1 answer
  • the tendency of minerals to break along smooth, flat surfaces is called _____. Streak fracture cleavage luster
    8·2 answers
  • the molecule ATP is composed of elements commonly found in organic molecules. which of the following is one of these elements? A
    12·2 answers
  • 12. Which of the following information is given to participants in clinical trials as part of obtaining informed consent?
    5·1 answer
  • An _______________ is a group of organisms and other non-living parts of the environment that lives in an area.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!