1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lakkis [162]
3 years ago
10

A population of deer is separated by an emerging volcano. The two populations come back into contact 200 years later, but are in

capable of breeding. Which of the following best describes the process that occurred?

Biology
2 answers:
Sever21 [200]3 years ago
7 0
Answer - Speciation 

Reasoning - Pretty much what has happen was the two species has evolved over the course of evolution if you want to put it that way why the are incapable of breeding.


Aleksandr [31]3 years ago
4 0

B: Speciation for sure

You might be interested in
6. What responsibility should fathers have to ensure the health of the<br> developing fetus?
____ [38]

Answer:

Father should give her healthy food

Explanation:

when mother eat healthy food the child which was in the womb of her will get nutritional energy then child health will be nice.

6 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Why do some bad tasting,bad smelling,toxic,or stinging species evolve bright colors?
Aleks04 [339]

Aposematic coloration is often called a warning coloration, letting other other animals know not to get near it

7 0
3 years ago
Science a:Class B;kingdom c:order or d:phylum​
dusya [7]

Answer:

A. Class

Explanation:

Kingdom can be answered but the most specific is class

6 0
3 years ago
In a scientific study, a conclusion can?
Vedmedyk [2.9K]
In a scientific study, a conclusion can state a theory
3 0
3 years ago
Other questions:
  • What are the six kingdoms of life?​
    8·1 answer
  • What Are animals that eat dead animals remains
    7·1 answer
  • What is the temperature of earths layers?
    14·2 answers
  • What are the two types of minerals?
    14·2 answers
  • What are two ways bacteria and protists can be helpful to people?
    13·1 answer
  • What is the green pigment called?
    11·1 answer
  • A microbe is discovered living in an extreme environment near a deep sea vent. The microorganism lacks a nucleus and peptidoglyc
    9·1 answer
  • Which of these options represents the correct flow of events during meiosis ii?
    7·1 answer
  • In addition to serving as waterproof coverings or as parts of biological membranes
    12·1 answer
  • Do non-human primates have culture? Why or why not
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!