1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
3 years ago
10

What are some challenges animals might face when migrating?

Biology
2 answers:
Andreas93 [3]3 years ago
3 0

Answer:

Some challenges animals might face when migrating are disease, global climate change, overexploitation, and habitat destruction.

Explanation:

In virtually every corner of the globe, migratory animals face a growing array of threats, including habitat destruction, overexploitation, disease, and global climate change. Saving the great migrations will be one of the most difficult conservation challenges of the 21st century.

lilavasa [31]3 years ago
3 0

Answer:

Lack of food

Explanation:

You might be interested in
Mendel accounted for the observation that traits that had disappeared in the f1 generation reappeared in the f2 generation by pr
marysya [2.9K]

Answer:

Option C,  traits can be dominant or recessive, and the recessive traits were obscured by the dominant ones in the F1.

Explanation:

Complete question-

Mendel accounted for the observation that traits which had disappeared in the F1 generation reappeared in the F2 generation by proposing that

Select one:

a. new mutations were frequently generated in the F2 progeny, "reinventing" traits that had been lost in the F1.

b. the mechanism controlling the appearance of traits was different between the F1 and the F2 plants.

c. traits can be dominant or recessive, and the recessive traits were obscured by the dominant ones in the F1.

d. the traits were lost in the F1 due to dominance of the parental traits.

e. members of the F1 generation had only one allele for each trait, but members of the F2 had two alleles for each trait.

Solution -

In the Mendel’s experiment, some traits which were absent in the F1 generation appeared in the second generation cross. By this he concluded, that the traits exressed in the F1 generation were dominant and hence they capped the expression of traits associated witl recessive allele. He classified the traits in F2 generation as recessive, because these traits can occur only when they are in pair i.e they form individuals with homozygous recessive genotype.  

For instance – If “R” is allele for dominant red color trait and “r” is the allele for recessive white color trait, then the cross between true breeding red flowers and white flowers will produce following offspring  

RR * rr

Rr, Rr, Rr, Rr

Thus, in F1 generation all the offspring are heterozygous red

F2 generation-  

Rr * Rr

RR, Rr, Rr, rr

The recessive trait of white colored flower reappears in second generation.

Hence, option C is correct

8 0
3 years ago
If a corn plant was heterozygous for kernel color and seed shape, what would be the genotype of the plant?
NNADVOKAT [17]

Answer:

<em>The genotype of the plant will be PpSs and the phenotype will be purple colour and smooth shaped. </em>

Explanation:

Considering the description in the question, we know that purple colour is dominant over the yellow colour and smooth shape is dominant over the wrinkled shape.

A homozygous trait can be described as a trait which arises due to the same alleles of a gene. A heterozygous trait arises when both the alleles of a gene are different. In such a case, one allele will be dominant over the other one and the phenotype of the dominant allele will be seen in the plant. As purple colour and smooth shape are dominant traits, hence they will be seen in the heterozygous plant.

8 0
3 years ago
What are nucleobases?
Charra [1.4K]

Answer:

B

Explanation:

Nucleobases, also known as nitrogenous bases or often simply bases, are nitrogen-containing biological compounds that form nucleosides, which in turn are components of nucleotides, with all of these monomers constituting the basic building blocks of nucleic acids.

3 0
3 years ago
Why can’t we see the shape of dna
skelet666 [1.2K]

Answer:

we can see the shape of dna

Explanation:

5 0
2 years ago
Read 2 more answers
An earthquake creates a new canyon in a mountain area. this canyon separates two populations of mountain turtles to the east and
kondor19780726 [428]
The formation of the canyon provides a physical barrier that me lead to speciation between the two populations if interbreeding is prevented. The population to the west of the canyon will probably adapt to feeding on the berries on land, and might therefore evolve traits for a terrestrial, vegetarian existence. The turtles to the east of the canyon will evolve to take advantage of the river environment, and aquatic characteristics will be further emphasised. 
4 0
3 years ago
Other questions:
  • What molecule is the electron acceptor of glycolysis
    9·1 answer
  • What technique is used by all three branches of science to make discoveries
    13·1 answer
  • Most atoms contain one or more
    10·2 answers
  • Write out the form of the partial fraction decomposition of the function (See Example). Do not determine the numerical values of
    6·1 answer
  • Which factor does not play a role in runoff
    6·1 answer
  • Suppose a family replaces ten 60-watt incandescent bulbs with ten 30-watt fluorescent lamps. If each light was used for 4 hours
    8·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • I WILL GIVE BRAINLIEST!!!!!!!!! Name at least three adaptations that allow reptiles to live entirely on land.
    6·2 answers
  • Look at the photo. Explain how it shows both an individual and a community
    6·1 answer
  • 4. Examine the codon chart and list all of the codons that code for
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!