1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
9

How does oxygen production relate to the rate of photosynthesis?

Biology
2 answers:
Karo-lina-s [1.5K]3 years ago
6 0
With less oxygen there is less carbon dioxide being produced for the plants so photosynthesis decreases.
gulaghasi [49]3 years ago
5 0
Well, it relates by how much water the plant sucks up and how much water is oxidized to make oxygen which is release throught the plants stomatas. Here is the equation for what happens to water during photosynthesis: H2O--> 1/2 O2 + 2H+ + 2e- The plant needs the H+'s from the water to make ATP and the plant needs the electrons given off by oxidizing water to go in the electron transport chain. Oxidizing is when a molecule loses electrons. H2O lost electrons to create O2
You might be interested in
Help!!! The question is in the picture.
Natali [406]

Answer:

18 is the nuclesus, 20 is the smooth endoplasmic reticulum and 21 is the golgi apparatus and 19 is the microtubes and 17 is the vacules.

Explanation:

5 0
2 years ago
What do scientists assume a thin ring indicates when analyzing tree rings?
Anarel [89]

Answer:

A. a year that was cool or dry

Explanation:

3 0
1 year ago
What is obligatory parasite
Shtirlitz [24]

An obligatory parasite is a parasite that can not complete its life cycle without exploiting a suitable host

6 0
3 years ago
What can the student conclude about her hypothesis based on the results?
solong [7]

Answer: The results will tell us about the correctness of hypothesis.

<u>Explanation:</u>

The Hypothesis is that explanation which is used as a starting of any investigation. The Hypothesis can or cannot be correct. We can test the hypothesis with scientific research.

Now a student can make conclusions about the hypothesis based on the results obtained. If results are the same as the hypothesis it means that our proposed explanation i.e hypothesis was correct but if the result differs than it means the hypothesis was not correct.

7 0
3 years ago
How many countries does the amazon rainforest cover?.
Nikolay [14]

\huge \fbox \pink{8 \: countries}

8 0
2 years ago
Read 2 more answers
Other questions:
  • Name two gases in the atmosphere that are essential for life
    14·2 answers
  • What is the main cause of an earthquake?
    15·2 answers
  • Matching: Match each description with the correct term.
    12·2 answers
  • How many chromosomes do humans with down syndrome have?
    6·1 answer
  • ________ is a condition in an experiment that remains the same.
    14·1 answer
  • Equation of photosynthesis
    10·1 answer
  • 1 Choose the two main ideas and write them in each empty box labeled
    14·1 answer
  • Which of the following statements about the deciduous forests is true​
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Who might benefit from this claim?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!