1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
9

How does oxygen production relate to the rate of photosynthesis?

Biology
2 answers:
Karo-lina-s [1.5K]3 years ago
6 0
With less oxygen there is less carbon dioxide being produced for the plants so photosynthesis decreases.
gulaghasi [49]3 years ago
5 0
Well, it relates by how much water the plant sucks up and how much water is oxidized to make oxygen which is release throught the plants stomatas. Here is the equation for what happens to water during photosynthesis: H2O--> 1/2 O2 + 2H+ + 2e- The plant needs the H+'s from the water to make ATP and the plant needs the electrons given off by oxidizing water to go in the electron transport chain. Oxidizing is when a molecule loses electrons. H2O lost electrons to create O2
You might be interested in
I’ll give points + brainalist (:
Vsevolod [243]

Your answer would be C. because the rest of potential energy. This one is not stored energy, it's kinetic.

Hope this helps; have a great day!

5 0
2 years ago
Read 2 more answers
Which of these statements best describes the role of creativity in science?
seropon [69]
The Correct answer is B
4 0
3 years ago
What is the symbol equation for aerobic respiration?
sdas [7]
Hey There Maiam,

<span>What is the symbol equation for aerobic respiration?

Answer: </span><span>1. </span>Aerobic Respiration<span>. It is important that you learn both the word and chemical </span>equation<span>. In the above </span>equations<span> we see that glucose is broken down by oxygen to release energy with carbon dioxide and water being produced as by-products of the reaction</span>
4 0
3 years ago
Almost all coal used today was produced during the Carboniferous period from dead animals in the swamps.
Ann [662]

Answer:

False

Explanation:

Almost all coal that is used today has its origins in the Carboniferous period. The Carboniferous period was a warm and wet one, with the majority of the land being swampy and covered with dense rainforests of ancient tree species. By the end of this period, the climate quickly changed, resulting int he collapse of the rainforests. As the trees were dying out, they were falling in the swamps, quickly being covered by the mud, so remaining largely preserved. Over time they got exposed to higher pressure and temperatures as they were getting deeper into the crust, eventually resulting in the formation of the coal.

7 0
3 years ago
Describe the three stages of a volcano.
dimaraw [331]

Answer:

active, dormant, and extinct.

Explanation:

 An active volcano is one which has recently erupted and there is a possibility that it may erupt soon.

A dormant volcano is one which has not erupted in a long time but there is a possibility it can erupt in the future.

An extinct volcano is one which has erupted thousands of years ago and there’s no possibility of eruption.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Sally and Maria hypothesized that earthworms lived only in dark, damp places. They measured a one-meter square in a shady spot n
    5·2 answers
  • List these events in the correct order for CSF flow in the CNS. a: CSF flows into the arachnoid villi b: CSF enters the blood c:
    14·1 answer
  • Am I correct on the question above?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Using the graphs below, determine which water drop rate leads to the highest seed growth.
    9·1 answer
  • A sample of gold has a mass of 38,6 grams and a volume of 2 cm What is the density of gold?
    15·1 answer
  • Myostatin is and example of
    7·1 answer
  • 4. According to the Hot Spots and Plumes Lab, there was no evidence that the Pacific Plate has changed direction.
    14·1 answer
  • What is the complementary DNA for TACGGCTTA
    11·1 answer
  • 1) The human population is currently over 7 billion and is continuing to grow. Which of these is a benefit of a growing
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!