1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Makovka662 [10]
3 years ago
13

A nurse is teaching a patient about insulin. which information should the nurse include? insulin is primarily regulated by:

Biology
1 answer:
Bezzdna [24]3 years ago
6 0
It is regulated by a <span>metabolic rate b serum glucose levels</span>
You might be interested in
6N right and 10N &amp; 2N left
Vinil7 [7]
What? I am confused.
4 0
3 years ago
Could someone please help me with this ASAP thank you!
Oksanka [162]

Answer:

11. Muscular Organ

12. Veins

13. Arteries

7 0
3 years ago
Read 2 more answers
Question 8(Multiple Choice Worth 4 points)
solong [7]

Answer:

D/ Kilograms per cubic-centimeter

7 0
2 years ago
Read 2 more answers
_____ is a process that helps fuel your metabolism.
Nostrana [21]

Answer:

hydro

Explanation:

4 0
2 years ago
(b) What major biological concepts, in
kolezko [41]

Answer:

Biology can simply be described as the study of living organisms. Biology is divided into many sub categories depending on the features of life that we want to study. For example, molecular biology is the study of molecules which make up living organisms.

Zoology can be described as a branch of biology under which animals are studied. The field of zoology involved studying the taxonomy of animals, their evolutionary histories, physiology, embryology etc. All these studies are  parts of biology hence zoology and biology are related.

Apart from these other unifying principles shared between zoology and biology are genetics, cell biology, population biology,biochemistry etc.

6 0
3 years ago
Other questions:
  • Carol saw a streak of light across the night sky; she called it a shooting star, what did she actually see? (10 Points)
    12·2 answers
  • Which natural disaster actually increases biodiversity over the long term?
    13·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What was Charles Darwin's scientific breakthough?
    13·2 answers
  • Arthropods invaded land about 100 million years before vertebrates did so. This most clearly implies that
    15·1 answer
  • Tall pea plants are dominant over short pea plants. If there are 200 short plants in the F2 generation from a cross that followe
    12·1 answer
  • In the hierarchy of scientific thought, a hypothesis: A. Comes right before law B.has the most certainty C. is the least certain
    6·2 answers
  • Nucleic acid found within chromosomes sometimes called the molecule of life. true or false
    6·1 answer
  • What is a hypothesis? a conclusion made based on facts a suggested answer to a problem a widely accepted idea information collec
    14·2 answers
  • Match these items to the correct being.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!