1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
7

Which is the correct process of human embryo

Biology
1 answer:
tatyana61 [14]3 years ago
3 0
Human embryogenesis is the process of cell division and cellular differentiation of the embryo that occurs during the early stages of development. In biological terms, human development entails growth from a one-celled zygote to an adult human being. Fertilisation occurs when the sperm cell seccessfully enters a fusion with an egg cell (ovum). The genetic material of the sperm and egg then combine to firm a single cell called zygote and the germinal stage of prenatal development commences. Embryogenesis covers the first eight weeks of development; at the beginning of the ninth week the embryo is termed a fetus. Human embryology is the study of this development during the first eight weeks after fertilization. The normal period of gestation (pregnancy) is nine months or 38 weeks.

- I hope this helps! (:
You might be interested in
How do human societies influence natural processes such as primary<br> succession?
Elenna [48]

Answer:

Hope it helps plss mark as brainlist

Explanation:

This succession is influenced by environmental factors such as soil type, water regimes, vegetation history, climate, and invasive species. Humans affect all of these factors. ... More human presence in the landscape increases the risk of exotic invasive species spread

3 0
4 years ago
Change in the _______ of breathing is accomplished by altering the amount of time spent in both inspiration and expiration, wher
GaryK [48]

Answer:

Rate and depth.

Explanation:

Breathing may be defined as the process of intake of oxygen and exhalation of carbon dioxide. The inhalation and exhalation depends on the partial pressure of gases, atmosphere and pressure of alveoli.

The breathing rate can be changed easily by increasing or decreasing the time of inspiration and the expiration. This changes the volume of oxygen and carbon dioxide in the body. The depth of breathing is controlled by the respiratory center present in the brain. The stimulation of the accessory muscles may increase the thoracic volume change and alters the breathing depth.

Thus, the answer is rate and depth.  

5 0
3 years ago
How do vaccines help to possibly protect you from the symptoms of a virus?
DaniilM [7]
To make sure your body is healthy , and fights them off .
3 0
4 years ago
Read 2 more answers
What foods from each food group would provide a balanced breakfast<br><br><br> HSLSODIDBDLDO HELP
Yakvenalex [24]

Answer:

A well-balanced breakfast includes foods from at least three out of the five food groups. Whole grain breads and cereals; low-fat dairy products, and fruit are typical breakfast choices. Choosing a high-fiber cereal with low-fat milk or yogurt for breakfast has been linked to improved weight or weight loss.

if it works please mark me as brainliest

6 0
3 years ago
Read 2 more answers
Summarize the path of an oxygen molecule from the nose to the bloodstream the​
Galina-37 [17]

Answer:

The oxygen molecule passes through the wall of the alveoli and enters inside tiny blood vessels called capillaries where exchange occurs.  A protein called hemoglobin in the red blood cells then carries the oxygen around your body.

Explanation:

8 0
3 years ago
Other questions:
  • After Frida stops exercising, she continues to breathe heavily. What is most likely occurring in her body? Heavy breathing durin
    5·2 answers
  • What food chain is represented in the above food web?
    8·2 answers
  • Blood is leaving the genitals, the erection subsides, muscles relax, and breathing and heart rate return to normal. Which stage
    6·1 answer
  • Energy, growth, evolutionary, and ecological describe different biological _____.
    8·1 answer
  • How is motion recognized​
    5·1 answer
  • A zebra needs water to survive. The zebra walks to the watering hole each morning. Which level of organization best describes th
    7·1 answer
  • When Charles Darwin arrived in South America what observation did he make regarding rabbits?
    15·1 answer
  • Please select the word from the list that best fits the definition
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • When two aqueous solutions that differ in solute concentration are placed on either side of a semipermeable membrane and osmosis
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!