1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
11

Why does the northern hemisphere have summer in June

Biology
1 answer:
irina [24]3 years ago
6 0

It is summer in June in the Northern Hemisphere because the sun's rays hit that part of Earth more directly than at any other time of the year. It is winter in December in the Northern Hemisphere, because that is when it is the South Pole's turn to be tilted toward the sun.

You might be interested in
When substances are put together, broken into their most basic particles, and spread evenly through another substance they form
Colt1911 [192]
They form a Solution.
4 0
3 years ago
Irish Setters are type of dog. In Irish Setters, the allele for red coat color (R) is dominant over the allele for brown coat
GREYUIT [131]

Answer:

2 Rr, 2 rr. (2:2 ratio)

Explanation:

The offspring will be Rr Rr and rr rr.

Since the red coated parent is heterozygous the recessive gene will have more of a chance to show when bred with the recessive brown Irish Setter.

<em>Hope this is correct. Have a great day.</em>

7 0
3 years ago
Fibrous joints are held together by?
Ugo [173]
⭐️The answer is ⭐️


Fibrous joints are connected by dense connective tissue consisting mainly of collagen. These joints are also called fixed or immovable joints because they do not move. Fibrous joints have no joint cavity and are connected via fibrous connective tissue. The skull bones are connected by fibrous joints called sutures.
3 0
3 years ago
Which of the following statements is TRUE?
jarptica [38.1K]

Answer:

None of these is true. (Ans e.)

Explanation:

C) Inhaled chemicals can irritate the throat or nose, damage the lungs, and enter through the lung to the bloodstream.

A) Skin is not impermeable in nature.

B) It is not safe to smoke around hazardous chemicals, as long as you wear gloves, because people can carry hazardous chemicals from cigarette smoke then releasing those compounds into non-smoking environments.

D) Alkaline can denature proteins, and they also break down fats in a process which is known as saponification. Burns from alkalines worse than burns from acids.

4 0
3 years ago
Which term describes the number of different species in an area?
labwork [276]

Answer:

Biodiversity

Explanation:

Biodiversity is the variety of life in a habitat or ecosystem

7 0
3 years ago
Other questions:
  • Explain very simply how the X-ray diffraction process aid in solving the structure of biologic molecules.
    7·1 answer
  • Based on the parents' genotypes, what is the genotypic ratio expected from a monohybrid cross between the two parents for the tr
    10·1 answer
  • Which might be a cause for the increase in songbirds at the feeders?
    8·2 answers
  • 1. Explain what is the "Sea Floor Spread" with examples.
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • ¿Cuál es el hidrato de carbono que aporta energía en la primera instancia?
    6·1 answer
  • A deer eats grass . Only ten percent of the energy from the grass is transferred to the deer . Where does the other 90% of the e
    13·1 answer
  • What did Gregor Mendel do to study different characteristics in his genetics experiments?
    6·1 answer
  • WILL GIVE BRAINLIST TO BEST ANSWER
    15·1 answer
  • To sterilize the nutrient broth and nutrient agar, the tubes and bottles are __________.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!