1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
3 years ago
11

How are asthma hyperventilation and anaphylactic shock alike?

Biology
1 answer:
jenyasd209 [6]3 years ago
8 0
In both you are unable to breathe.
You might be interested in
Which statement correctly describes the rock cycle?
Ede4ka [16]
I’m pretty sure it’s D, the others don’t make sense??
6 0
2 years ago
What is NOT a function of the
Arada [10]

Answer:

function as the powerhouse of cell

Explanation:

we have read the power house of cell as a mitochondria

8 0
3 years ago
Read 2 more answers
I need to make a food chain with these animals
Gwar [14]

Answer:

Flower -> Insect -> small fish -> Big fish -> Seagull

Explanation:

All of these animals are eaten by the one arrow is pointing to.

7 0
3 years ago
Read 2 more answers
Explain how the release of additional eggs is prevented during pregnancy? ​
Rus_ich [418]

Progesterone and estrogens are thought responsible for the release (and prevention of release) of an egg during ovulation

3 0
3 years ago
Edwin Hubble was an American astronomer who played a crucial role in collecting evidence to support the theory that the universe
Masja [62]

Answer:

C

Explanation:

These type of questions leave a great deal to be desired. There is no mention of which way Hubble used and manipulated data. He studied the variations in light to determine his conclusions.

Nor is there any mention of what Lomonosov did to come to the conclusion that conservation of mass is a constant.

We don't know what was done to get the results. Hubble was studying the universe; the conclusions made by Lomonosov depended on lab equipment that was very delicate (I'm assuming). I doubt he manipulated variables. He measured what he got.

I think the answer is C, but the question has so many assumptions that it is hard to know what answer to pick.

5 0
3 years ago
Other questions:
  • Which important complex is formed due to complimentary binding at the enzyme active site?
    14·2 answers
  • How can an angiotensin converting enzyme inhibitor (ace inhibitor) such as captopril be effective as an antihypertensive? how ca
    7·1 answer
  • How is a nuclear envelope similar to a cell membrane
    8·2 answers
  • Which planet was formed first in out solar system
    14·2 answers
  • What is the cause of diabetes ? How can a doctor treat a diabetic patient?
    11·1 answer
  • Proteoglycans are a group of macromolecules formed from: a. proteins and glycosaminoglycans. b. proteases and glycosaminoglycans
    9·1 answer
  • Is there a symbiotic relationship between plants and water? If so, what effect does it have on their ecosystem?
    9·1 answer
  • What is political machine
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which of the following technologies would likely involve a bioengineer to design and build?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!