1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
4 years ago
11

How are asthma hyperventilation and anaphylactic shock alike?

Biology
1 answer:
jenyasd209 [6]4 years ago
8 0
In both you are unable to breathe.
You might be interested in
A biologist who follows the _________ paradigm assumes that each part of a living organism is an adaptation and that the functio
attashe74 [19]

Answer:

Reductionism  

Explanation:

Reductionism is a philosophical theory used to explain different phenomena from simpler phenomena. This idea represents a useful methodology to understand complex processes, and it is widely used in molecular biology and genetics research fields

7 0
4 years ago
Without feedback, what would happen to a person's height?<br><br> HELP ASAP PLZ
mars1129 [50]

Answer:

nothing would happen to a persons height, it depends if they're still growing because of there age

Explanation:

4 0
3 years ago
Read 2 more answers
By about ____ months of age, different circuits in the brain begin to control infants’ looking at faces, allowing infants to dis
mojhsa [17]

Answer: 2-3

Explanation:

A biological neural network or neural circuit is a set of ordered synaptic connections that occur as a result of the binding of neurons to others in their corresponding regions following neural migration. At birth, a baby has an average of 100 billion neurons, but few neural connections. These will multiply as the child grows, through environmental, sensory, cognitive and movement stimulation. <u>Stimulating mobility and physical activity also has a positive effect on cognitive functioning by modifying the activity of certain brain areas</u>. Physical exercise has beneficial effects on brain function, such as promoting neuroplasticity and increasing learning and memory performance, which may be due to increased expression of various neural growth factors.

<u>Finally, environmental stimulation is basic for harmonious brain development and for laying the neurophysiological foundations of our children's future brains. </u>Thus, there are many mechanisms that nature has at its disposal to prevent babies from being left helpless.  All of them favour their relationship with adults and thus their neurons, at a time of maximum growth of their extensions, can form the brain circuits that allow the acquisitions that make them advance in their neurodevelopment. If babies do not receive from their adults sufficient affection and attention, brain growth will be much less and their neurodevelopment will inevitably be delayed, because what makes the brain grow and change is precisely the creation of new circuits as it learns new things, and those who can learn most are the most experienced. By aboyt 2-3 months is when circuits of the brain begin to be created.

7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
FUN FACT:<br> the Swine flu was a strand of Coronavirus
DanielleElmas [232]

Answer:

thats not scary at all

Explanation:

jk it is

4 0
3 years ago
Other questions:
  • Plz help ASAP!!!!!!!!!
    7·2 answers
  • The nurse is caring for a client before, during, and immediately after surgery. which type of care is provided to the client?
    15·1 answer
  • Smart growth is an urban planning theory that promotes the development of suburbs surrounding major city centers.
    10·1 answer
  • Secondary growth in stems is usually seen in ________.
    8·1 answer
  • Parents that are heterozygous for having freckles (dominant) are crossed.
    8·1 answer
  • The amino acids coded by specific condons
    7·1 answer
  • Who knows how to do this pls answer it 100% smart pls tell me the correct answer smart people
    8·1 answer
  • Will give 30 pts
    9·1 answer
  • How can you prevent oil spills from interfering with storms?<br> Need at least 5 reasons.
    12·1 answer
  • Which component of a urinalysis reflects the amount of waste products and solids in urine?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!