Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
B. To explain how things work
The cytoplasmic fragments of the megakaryocytes constitute the platelets, this fragments simultaneously into thousands of new platelet cells, these morphological changes are known as proplatelets.
<h3>What are proplatelets?</h3>
They are cytoplasmic protrusions from which platelets or fragments are going to be detached that end up maturing in the circulation.
<h3>Characteristics of proplatelets</h3>
- Platelets are formed from the fragmentation of giant cells, which emit cytoplasmic protrusions.
- Each megakaryocyte has about 6 proplatelets, and each proplatelet houses about 8,000 platelets, these "bags" full of platelets enter the bloodstream where they break, releasing them.
Therefore, we can conclude that the megakaryocytes form the future platelets, these platelets are grouped in cytoplasmic portions, called proplatelets.
Learn more about platelets here: brainly.com/question/4670766
Responder: Un pronóstico de siete días puede predecir con precisión el clima alrededor del 80 por ciento del tiempo y un pronóstico de cinco días puede predecir con precisión el clima aproximadamente el 90 por ciento del tiempo. Dado que no podemos recopilar datos del futuro, los modelos tienen que usar estimaciones y suposiciones para predecir el clima futuro.
Answer:
Answer is C.
Explanation:
Electrophoresis describes the movement of particles in a gel, influenced by an electric charge.
It is use to separate DNA particles based on their charge and size. Some of its types are native or buffer gels, gradient gels among others.
