1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
11

Organelle job description

Biology
1 answer:
Reil [10]3 years ago
4 0

An organelle is the organs of a cell like our body. So each organelle have different jobs. Like a mitochondria produces ATP energy for us to live and work. A vesicle transports proteins and a Ribosome synthesise proteins and respirats  the cell

You might be interested in
Which of the following describes a difference between galaxies and solar systems?
LuckyWell [14K]

Answer:

A galaxy is a collection of millions of stars, while a solar system is a star and the planets around it.

Explanation:

You live in a solar system, we revolve around our sun and so do the other planets making up a solar system

3 0
3 years ago
Read 2 more answers
What is the answer please help yall
Phantasy [73]

Answer:

That's correct im pretty sure

Explanation:

Because you are adding a nucleotide which is a frameshift mutation.

5 0
3 years ago
Read 2 more answers
The energy in the rabbit came from the grass without changing
kondor19780726 [428]
False..the energy was depleted just a little..lets say a wolf comes and eats the rabbit..then the energy in the rabbit from grass will deplete a little more and so forth if a human comes and kills the wolf and eats it...the energy always goes down a bit
8 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
When comparing the skin cells from a dog to bacterial cells which observation would be false
NemiM [27]
Answer:  the dogs skin cells contain cell walls<span>
When comparing the skin cells from a dog to bacterial cells, which observation would be false?</span>
6 0
4 years ago
Read 2 more answers
Other questions:
  • Any _______ has _______ set(s) of physical and chemical properties.
    5·2 answers
  • What time of day does cellular respiration occur?
    6·1 answer
  • In an ecosystem, which is not a density-dependent limiting factor?
    14·2 answers
  • . A homozygous for tall and heterozygous for green pods plant is crossed with a plant heterozygous for tall and has yellow pods.
    10·1 answer
  • If a brown-eyed mother and a blue-eyed father
    8·1 answer
  • Florida can be described as a peninsula, surrounded on three sides by salt water: the Atlantic Ocean and the Gulf of Mexico. The
    13·2 answers
  • The cheetah is the fastest land animal accelerating from 0 to 100 km per hour in hour many seconds? 1) 2 seconds 2) 3 seconds 3)
    13·1 answer
  • What phase of matter is phosphorus not typically found in?
    14·1 answer
  • Why is geotropism important to plants?​
    6·1 answer
  • Axons insulated by a(n) _____ are able to conduct impulses faster that those not so insulated.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!