1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balandron [24]
3 years ago
15

Which of these are an important part of a scientific process?

Biology
2 answers:
valentinak56 [21]3 years ago
8 0

Answer:A

Explanation:

viva [34]3 years ago
4 0

Answer:

A.Testable hypotheses

it makes the most sense out of the rest

You might be interested in
Which statement is an accurate description of the relationship between rocks and minerals?
quester [9]
The best answer is C
Hope it helped!! :)
4 0
3 years ago
Read 2 more answers
A certain Drosophila protein-encoding gene has one intron. If a large sample of null alleles of this gene is examined, will any
Alex

Answer:

a) Yes

b) Yes

c) Yes

d) Yes

Explanation:

a. In the exons?

Yes mutant site will be expected. It will transcript-ed as well and it can be a polypeptide depending on the mutation type.

b. In the intron?

Yes mutant site will be expected. It will be transcript-ed as well and it cannot be a  polypeptide  

c. In the promoter?

Yes mutant site will be expected. It will not be transcript-ed and it cannot be a  polypeptide

d. In the intron-exon boundary?

Yes mutant site will be expected. It will be transcript-ed and it cannot be a  polypeptide

3 0
3 years ago
2.2.2 Quiz: Transcription
Karolina [17]

<u>Answer</u>:

Actions happens after transcription ends is "An mRNA molecule leaves the nucleus of the cell."

<u>Explanation</u>:

Transcription is the process of formation of mRNA from DNA. DNA is the genetic material which carries all the information for the formation of mRNA and then protein. Transcription occurs in nucleus, but as soon as the mRNA is formed it unwinds from the template DNA stand and moves into the cytoplasm for the next process i.e. translation. Translation occurs nearer to the ribosomes, it is the formation of protein from mRNA strand. combinedly transcription and translation are referred as the central dogma of the molecular biology.

8 0
3 years ago
Why would society use green roofs?
puteri [66]
They probably chose this over black since black absorbs he most heat, and if something like a power outage occurs during the hot summer, ya want to stay as cool as possible...this is just my idea.
5 0
3 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Other questions:
  • List three different functional types of insect (a) legs, (b) wings, and (c) mouthparts and give an example of each.
    13·2 answers
  • The major function(s) of the digestive system are:
    10·1 answer
  • Where in the lymph node is a dendritic cell most likely associated with a b or t lymphocyte? where in the lymph node is a dendri
    12·1 answer
  • 10.LID)..
    6·1 answer
  • Decode the messages <br><br> TAC CTC CTT TGA ATT TAC CTT ACT CGT TGT ATT AAA TAT <br> CAG GTC
    8·1 answer
  • The five distant planets are made up mostly of ?
    13·2 answers
  • What part of the muscle cell most closely regulates protein synthesis?
    8·1 answer
  • 3 points
    11·2 answers
  • What is Group 13 period 5 on the periodic table
    5·1 answer
  • Select all that apply. Head lice are tiny organisms that can be found on
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!