The best answer is C
Hope it helped!! :)
        
                    
             
        
        
        
Answer:
a) Yes
b) Yes
c) Yes
d) Yes
Explanation:
a.
In the exons?
Yes mutant site will be expected. It will transcript-ed as well and it can be a polypeptide depending on the mutation type. 
b.
In the intron?
Yes mutant site will be expected. It will be transcript-ed as well and it cannot be a  polypeptide  
c.
In the promoter?
Yes mutant site will be expected. It will not be transcript-ed and it cannot be a  polypeptide 
d.
In the intron-exon boundary?
Yes mutant site will be expected. It will be transcript-ed and it cannot be a  polypeptide 
 
        
             
        
        
        
<u>Answer</u>:
Actions happens after transcription ends is "An mRNA molecule leaves the nucleus of the cell."
<u>Explanation</u>:
Transcription is the process of formation of mRNA from DNA. DNA is the genetic material which carries all the information for the formation of mRNA and then protein. Transcription occurs in nucleus, but as soon as the mRNA is formed it unwinds from the template DNA stand and moves into the cytoplasm for the next process i.e. translation. Translation occurs nearer to the ribosomes, it is the formation of protein from mRNA strand. combinedly transcription and translation are referred as the central dogma of the molecular biology.
 
        
             
        
        
        
They probably chose this over black since black absorbs he most heat, and if something like a power outage occurs during the hot summer, ya want to stay as cool as possible...this is just my idea.
        
             
        
        
        
Answer:
 a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
 c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’