1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
suter [353]
3 years ago
9

Platelets start a clotting reaction that intimately produces a clot composed of fibrin, is a form of what

Biology
1 answer:
igor_vitrenko [27]3 years ago
3 0

Platelets start a clotting reaction that intimately produces a clot composed of fibrin, is a form of Fibrinogen

Explanation:

Fibrinogen is blood plasma Protein which is converted into those protein fibrins in the clotting process. After removal of clot the fibrinogen free fluid is obtained and this fluid is known as blood serum. It shows strong flow birefringence. It is highly viscous.

By half saturation process and using the sodium chloride fibrinogen can be participated from the blood plasma. Through thrombin process clotting is initiated. With the help of electron micrographs, its molecules look like a rod whose length is 47.5 nanometre.

You might be interested in
The G 1 stage of the cell cycle marks the beginning of the ________.
azamat
The correct answer is cell cycle
7 0
3 years ago
The final stage of general adaptation theory is known as
Dafna1 [17]
<h2>Exhaustion stage of general adaptation.</h2>

Explanation:

The final stage of general adaptation theory is known as exhaustion stage.

The general adaptation is  has been divided into three stages- Alarm stage, resistance stage and exhaustion stage.

The theory of adaptation describes the physiological changes that an organism undergoes when it is exposed to stress.

The first stage,which is the alarm stage which is characterized by the burst of energy and the stressor acts as a stimulus.

The second stage is the resistance stage when the organism develops the resistance against  stressor.

The last stage is the exhaustion stage when the energy is sufficiently depleted and the final adjustment is attained.

4 0
3 years ago
Study the image.
cricket20 [7]

Answer:

ur answer would be D.)is a region where earthquakes occur

Explanation:

got it right on EDGE 2020 test

hopes this helps !:)

3 0
2 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
How do the structures in an organism relate to their functions?
Volgvan
The structure<span> and </span>function relate<span> because what the </span>structure<span> is made of influences what the ... Therefore, it is fit to </span>do<span> the job of pumping blood around the body.</span>
6 0
2 years ago
Other questions:
  • What is connective tissue?
    7·1 answer
  • How would the karyotype of an organism that reproduces?
    15·1 answer
  • Which of the following are ways that humans increase the amount of greenhouse gases in the atmosphere
    15·1 answer
  • How have mendel's laws fared as we have learned more about cell biology and processes such as meiosis?
    13·1 answer
  • Is ammonia solution a weak or strong alkali?
    8·2 answers
  • DNA, rna, and starch: what do they all have in common
    9·1 answer
  • All organisms get energy from their environment. When a shark consumes food,
    10·2 answers
  • If the statement is true, write true. If the statement is false, change the underlined word
    9·1 answer
  • Using the Karyotype above, what chromosome has an error?<br> 1<br> 21<br> X<br> Y
    13·1 answer
  • The peoples of ancient mesopotamia tended to see the world as a hazardous place because:_______
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!