1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
6

List some other common units of energy. check all that apply.

Biology
1 answer:
Kay [80]3 years ago
6 0

Barrel of oil

Calorie

Horsepower

Joule (J)

Kilowatt-hour (kWh)

Kilowatt (kW)

Volt (V)

Watt (Electric) and (Thermal)



You might be interested in
Reconstruct the phylogeny that most simply and accurately accounts for the distribution of synapomorphies among ingroup species.
Alina [70]

Complete question:

1). Determine the character states for the following six characters that are present in species OG, 5, 7, 15, 17, 18. Assign the character state found in the outgroup (OG) as a 0 and the alternative derived state a 1; use only two states per character. Example, stem width: 0 = thin, / = thick 1 <em>(Characters and plant species image in the attached files)</em>

2). Score each taxon using the 0 and 1 notation about and add to this matrix <em>(Matrix in the attached files)</em>

4). Reconstruct the phylogeny that most simply and accurately accounts for the distribution of synapomorphies among ingroup species. Given matrices as small and simple as the above example, one can build the tree from the bottom up in a series of sketches, adding clades or branches representing groups with the fewest synapomorphies near the base of the tree and those with the most at the tips. Using the unlabeled phylogeny as a starting point, draw the stepwise construction of a fully resolved phylogeny to account for all of the synapomorphies and include the synapomorphies that identify each clade (the first one, character 2, is included to get you started; this is shared by all members of the ingroup) (<em>Tree in the attached files)</em>

Answer:

  • Characters:
  1. Stem width: Thick-1 // Thin-0
  2. Leaf edge (shape): Pointed-1 // Blunt-0  
  3. Flower base (shape): Narrow-0 // Wide-1
  4. Flower orientation: Downward (Pendant)-1 // Upward (Vertical)-0
  5. Petal color: Purple-1 // Yellow-0
  6. Fruit shape (inset on card, on left): Round-0 // Elongated-1
  • Complete Matrix in the attached files
  • Order in the phylogeny reconstruction: OG --> 7 --> 5 --> 15 --> 17 and 18 (tree + evolutive changes in the attached files)

Explanation:

<em>NOTE: You will find the complete activity in the attached files. </em>

  • The principle of maximum parsimony or maximum simplicity states that among all possible trees within a group of species, the most probable  is the one that requires us to postulate the least number of evolutionary changes. So, to reconstruct a phylogeny we need to choose the tree that requires the less number of changes.
  • To determine the character states for all the six characters, we assigned the number cero to all the characters expressed in the out-group. Thin steam, blunt leaf, narrow flower base, upward flower orientation, yellow petals, and rounded-seeds are all cero states. The other characters are 1.
  • The above information of character state was used to fill in the matrix, specifying which character state belongs to each species according to their traits.
  • The matrix was useful to reconstruct the phylogeny, to identify the autapomorphic trait, and to visualize all the clades.

8 0
3 years ago
What combines to form rocks<br><br>minerals <br>Crystal's<br>other rocks​
vampirchik [111]

Answer:

A rock is a collection of minerals. In a cooling lava, mineral crystals do not have time to form and are very small. The chemical composition will be the same as if the magma cooled slowly. Existing rocks may be heated enough so that the molecules are released from their structure and can move around.

Explanation:

6 0
3 years ago
Posted this 11 mins ago. No ones answered so Imma ask again.
xenn [34]

Answer:

Lactic Acid Fermentation, which <em>produces the ATP molecule that animals and bacteria need for energy.</em> Lactic acid fermentation occurs when the ATP molecule is created without oxygen.

Alcohol/Ethanol Fermentation, which <em>causes certain sugars to be converted into alcohol and carbon dioxide</em> by bacteria on carbohydrate products/materials.

8 0
3 years ago
Coin flipping simulates the events of mitosis and the production of sperm or eggs
a_sh-v [17]
Coin flipping simulates the events of mitosis and the production of sperm. This is because females carry XX chromosomes so all eggs will have a singular X chromosome. It is the sperm that determines the sex of the foetus: males have XY chromosomes and therefore sperm will carry either X or Y chromosomes (a 50/50 chance, just like flipping a coin)
5 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Hamish writes down some sentences to summarize the goal of classification.
    12·2 answers
  • What is an acid? What is a base?
    11·2 answers
  • When ATP is broken down in cells, __________ and __________ are the products.
    12·1 answer
  • With the exception of sensory neurons, the role of a neuron's __________ is to carry information toward the cell body, whereas t
    8·1 answer
  • The development of specialized tissues and organs in a multicellular organism's embryo occurs as a result of
    11·1 answer
  • An experiment that
    5·1 answer
  • if the half life of substance z is 2.5 years how long will it take for 48 grams of substance z to decay such that only 3 grams r
    12·1 answer
  • If the planets rotation stopped what is 1 thing that would most likely occur
    6·1 answer
  • Complete the following statements.
    7·2 answers
  • In the 2nd cycle what beings to appear
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!