1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
3 years ago
5

Complete the sentence to describe the similarities and differences between amylose and cellulose. Match the words to the appropr

iate blanks in the sentences on the right. Be certain each sentence is complete before submitting your answer. D-glucose | D-fructose | L-glucose | B-1,6-glycosidic | a-1,4-glycosidic | a-1.6-glycosidic | B-1,4-glycosidic | a branched | an unbrached | L-fructoseAmylose is _____ chain of _________ units connected by _________ bonds. Cellulose is _________ chain of _________ units connected by _________ bonds.
Biology
1 answer:
dmitriy555 [2]3 years ago
7 0

Answer:

Amylose is an unbrached chain of D-glucose units connected by a-1,4-glycosidic bonds.  

Cellulose is chain of D-fructose units connected by | B-1,4-glycosidic bonds.

Explanation:

Both, amylose and cellulose are polysaccharides, meaning that they consist of a large number of monosaccharide units. Alo, both form linear structures composed of D-glucose. Differences in those two sugars are that amylose is storage molecule in which glucose unit are connected with α-(1, 4)-glycosidic bond, while cellulose is a structural molecule in which glucose units are linked with β (1, 4) glycosidic bonds.

Amylose is component of starch. Cellulose is the main component of the plants' cell wall.

You might be interested in
Research by social scientists suggests that it takes ____ percent of the population of a community, country, or the world to bri
Lady bird [3.3K]

Answer:

<em>The correct option is B) 5-10%</em>

Explanation:

We have seen and depicted various scenarios where we see how different changes arise and dominate the world. Social scientists suggest that as low as 5-10% people of a population are enough to bring about a change because people tend to copy what others are doing. Same goes for countries of the world. Each new popular technique which is learnt by one country tends to become popular and learnt by other countries. For example, the usage of a social app starts with a few members of a population using it and with time it becomes popular in the whole world.

7 0
4 years ago
How will you set up a controlled experiment
satela [25.4K]
Research is necessary to gather data that is used to formulate a hypothesis and to create the experiment.

Identify a problem. The problem is the question you are trying to answer. Without a problem, there is no reason for experimentation.

Formulate a hypothesis. The hypothesis is a statement, based on your research, that is intended to provide a solution to the problem. The hypothesis is what you are trying to prove or disprove.

Conduct your experiment to prove the hypothesis. A controlled science experiment is setup to test whether a variable has a direct causal relationship on another.

Identify your independent and dependent variables. The independent variable is commonly known as the cause, while the dependent variable is the effect. For example, in the statement A causes B, A is the independent variable and B is the dependent. A controlled scientific experiment can only measure one variable at a time. If more than one variable is manipulated, it is impossible to say for certain which caused the end result and the experiment is invalidated.

Do not alter your hypothesis midway through the experiment. The setup of a controlled scientific experiment must be constant. You can not make changes once you have begun, even if the results you are getting do not seem to support your original hypothesis. When you change your hypothesis, you change the entire experiment and you must begin again.

Do not be upset if your results are not what you expect. Some of the greatest scientific advances have come from experiments that disproved the original hypothesis.

Start over again with a new hypothesis or find new variables to manipulate. Scientific advancement is a painstakingly slow process and scientists often spend years and even an entire lifetime working on the same problem.
3 0
4 years ago
A class of lipids used as chemical messengers (or hormones) derived from cholesterol are called?
Deffense [45]

A class of lipids derived from cholesterol are called steroids.

Steroids are important large class of biological molecules which are significant components of  cell membrane and signaling molecules.

6 0
4 years ago
What is the Major difference between the position of producers and primary consumers in the food chain.
dangina [55]

Producers can make their own food by capturing the sun's energy, but consumers don't. Consumers need to eat other organisms to obtain energy.

3 0
2 years ago
______________ is a statistical procedure that can be used to identify clusters of behaviors that are related to a trait.
Mamont248 [21]

Answer:

Factor  Analysis

Explanation:

Factor Analysis is a statistical procedure that can be used to identify clusters of behaviors (such as verbal skills, intelligence) that are related to a trait.

Factor analysis helps to accumulate a lot of data in many variables into a few variables which can be used for further analysis or study. The aim of factor analysis is to aggregate individual behaviors into a minimized number of factors.

7 0
3 years ago
Other questions:
  • Cold sores are caused by the herpes simplex virus type 1. a company that wants to develop antiviral drugs would ask a research i
    13·1 answer
  • Which had eukaryotic animal cells <br> a. oak <br> b.liver <br> c.virus <br> d. lactobacillus?
    6·1 answer
  • Ecosystems change when _______.
    7·2 answers
  • Which of the following correctly organizes these genetic terms in order from smallest to largest?
    15·2 answers
  • Compared to early hominid ancestors, modern humans have brains that are
    11·2 answers
  • List the terrestrial planets. Recount the goldilocks theory with respect to these planets
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • PLEASE NEED CORRECT ANSWERS ASAP 40 POINTS Gastric juices are secreted by glands which are located in the _____.
    11·1 answer
  • What conditions on Earth enable life to exist?
    12·1 answer
  • How long can blood flow to the brain be interrupted before death occurs?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!