1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sever21 [200]
3 years ago
9

When cells communicate by the signaling process, one cell produces a _________________blank that must be received by the _______

____blank on or in the responding cell?
Biology
1 answer:
My name is Ann [436]3 years ago
5 0

When cells communicate by the signaling process, one cell produces a signaling molecule that must be received by the signal receptor on or in the responding cell. Signaling molecules are often called ligands, a general term for molecules that bind specifically to other molecules (such as receptors).

You might be interested in
Help me plz <br>its for 9th grade biology or 10th grade​
shepuryov [24]

Answer:

The answer should be X^{A} Y^{A}

Since the pedigree has two different letters, it will have one letter of each, but the DNA will still be A.

3 0
2 years ago
An imbalance from the homeostasis perspective is considered to be
Aleks [24]

<span>When there is an imbalance from the homeostasis of the body, a disorder or disease may result. Homeostasis establishes balance and equilibrium of the internal and external part of the body. If this balance or ideal levels are interrupted, the body may correct it by making all system work together or the problem may worsen based on certain influences and may not allow normal functioning of the organism, by either deficiency or toxicity. </span>

Moreover, some factors that influence the body’s ability to maintain homeostatic balance are genetics, lifestyle choices and environmental exposure.

7 0
3 years ago
According to the _______ hypothesis, the moon formed far away from the earth and was later captured by the earth's gravity. The
Anit [1.1K]

Answer:

capture

giant impact hypothesis

electromagnetic spectrum

cold

14

The moon's mass is much lower than the earth's; therefore, its gravity isn't strong enough to hold an atmosphere. This lack of an atmosphere and the moon's small size allowed it to become cool enough to the point at which it completely solidified. Thus, the moon doesn't have any plate tectonic activity.

Explanation:

8 0
3 years ago
Read 2 more answers
Which muscle is the woman using to lift the ball over her head?
viva [34]

Answer:

its the biceps

hopw it helpsand plz mark me the brainliest

4 0
3 years ago
How are natural and enchanted greenhouse different
Katen [24]

Explanation:

The enhanced greenhouse effect, sometimes referred to as climate change or global warming, is the impact on the climate from the additional heat retained due to the increased amounts of carbon dioxide and other greenhouse gases that humans have released into the earths atmosphere since the industrial revolution.

5 0
3 years ago
Other questions:
  • An important response mechanism in our bodies is blood clotting. The response loop is initiated when injured tissue releases sig
    5·1 answer
  • Which of the following groups is present in amine compounds?
    10·1 answer
  • The Great Pacific Garbage Patch is best described as
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Noah has collected a mold specimen found on a tree in his backyard. Noah knows the mold is a decomposer, but what role does mold
    13·1 answer
  • Could someone explain the answer?<br> GIVING 12 POINTS
    5·1 answer
  • How are these cells different from other cells?
    10·1 answer
  • Anaerobic respiration occurs in both animal and plant cells. The process is similar in each type of cell, however each yields di
    7·1 answer
  • A sound with a large amplitude will transmit a
    10·1 answer
  • Mammalian target of rapamycin pathway mutations cause hemimegalencephaly and focal cortical dysplasia
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!