1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
3 years ago
9

The sugar and phosphate portion of the nucleotides are found _____ on the DNA twisted ladder.

Biology
1 answer:
Vesna [10]3 years ago
7 0
The sugar and phosphate portion of the nucleotides are found as segments of the rails on the DNA twisted ladder.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are the processes of biomass production in generation of gas. in a comprehensive way pls.​
zhuklara [117]

Thermochemical conversion is a process which is used to produce solid, gaseous, and liquid fuels.

<h3>What are the processes of biomass production in generation of gas</h3>

Biomass is converted into energy through various processes such as Direct combustion means burning to produce heat. Thermochemical conversion is a process which is used to produce solid, gaseous, and liquid fuels while on the other hand, Chemical conversion is a process to produce liquid fuels.

So we can conclude that thermochemical conversion is a process which is used to produce solid, gaseous, and liquid fuels.

Learn more about biomass here: brainly.com/question/82777

#SPJ1

3 0
2 years ago
Is using natural resources a sustainable practice? True or false pls tell me the answer i need hellppp
Lostsunrise [7]

Answer:

yes because it renews itself you wont have to worry about it running out.

Explanation:

6 0
3 years ago
The liver forms glucose from noncarbohydrates. stores vitamin
Viefleur [7K]
<span>The propositions are:
a. forms glucose from </span><span>noncarbohydrates
b. does all of these
c. destroys damaged red blood cells
d. stores vitamin D
e. forms urea

The right answer is: B. </span>does all of these

*The liver plays a role in the metabolism of carbohydrates:- gluconeogenesis (manufacture of a new glucose molecule from a non-carbohydrate molecule);- glycogenolysis (release of glucose from glycogen) under the effect of glucagon;- gluconeogenesis (storage of glucose in the form of glycogen) under the effect of insulin
*It stores fat-soluble vitamins (A, D, K and E) and glycogen.*It converts ammonia to urea (detoxification)<span>*It recycles substances from the senescent red blood cells.</span>
4 0
3 years ago
Describe one important way on how to behave properly when conducting experiments
Usimov [2.4K]

Answer:

ok

Explanation:

6 0
3 years ago
Other questions:
  • The hippocampus a) aids in balance and control of body movement. b) contributes to dramatic gains in motor coordination. c) play
    5·1 answer
  • PLEASE HELP ASAP
    5·1 answer
  • Describe the differences in the way the sand castle is changed by an ocean wave and by Dylan stomping on it
    11·1 answer
  • The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most s
    6·1 answer
  • Why is the pituitary gland so important?​
    10·1 answer
  • Which is an example of negative feedback? Group of answer choices
    13·1 answer
  • Which sphere of the earth system includes trees grasses and squirrels?
    8·1 answer
  • How liver performs homeostatic functions?
    6·1 answer
  • Where does oxygen that is produced during photosynthesis come from ?
    7·1 answer
  • Study this image.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!