1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naya [18.7K]
3 years ago
9

Which of the following is not a function of stems?

Biology
1 answer:
eimsori [14]3 years ago
5 0
A) Anchorage
I'm not sure
You might be interested in
Some important traits that influence the reproductive success of a flower include: the presence or absence of ____________ , the
Sonja [21]

1. Whorls

2. Organs

3. Symmetry

<u>Explanation:</u>

Some important traits that influence the reproductive success of a flower include: the presence or absence of whorls, the fusion of organs to one another, and the overall symmetry of flowers.

In the process of reproduction in plants, the male and female gametes are produced and transfer of the male gametes to the female ovules occurs. This process is called as pollination. After pollination occurs, fertilization happens and the ovules grow into seeds within a fruit

Floral  zygomorphy confers a reproductive advantage to rare plants" as a result of the  enhanced pollination efficiency.

3 0
3 years ago
Which of the following is the definition for speciation?
Leona [35]

ANSWER:

I think it is the first one

Explanation:

Speciation is the process in which new species are created through evolution. I might be wrong though.

the evolutionary process through which new species emerge

5 0
1 year ago
Vhat do scientists need to look at before developing an argument?
ikadub [295]

Answer:

The validity of data, claims, hypotheses, and observations.

Explanation:

Making an argument and discussion over the scientific arguments are considered important to the scientific method.

The argument should be made in a way that it should check the validity of the hypothesis. The scientist who has to make an argument should consider various steps of scientific method like hypothesis which should predict the explanation of the natural phenomenon.

The person should consider the validity of the data whether it supports the hypothesis or not and observation of the experiment.

Thus, the selected option is the correct answer.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which time is most likely an outlier
mestny [16]

maybe 1:00????

im  just trying to help :C

7 0
3 years ago
Other questions:
  • Coccidioidomycosis may develop when Coccidioides immitis _______ are inhaled.
    10·1 answer
  • What vitamin derivative is used in medications for skin wrinkling and acne. health in later years?
    11·1 answer
  • Air has mass and takes up space. What can we say about air?
    14·1 answer
  • Question: Which substance is a product of cellular respiration ?
    12·1 answer
  • Some proteins on the surface of a mammalian cell contain carbohydrates. These proteins are synthesized by _______ and the sugars
    8·1 answer
  • Severing a cat's reticular formation from higher brain regions causes the cat to:
    14·1 answer
  • How water quality changes from source of a river to the mouth
    11·1 answer
  • What is the process of Asexual and Sexual reproduction of Jellyfish?<br> Plz give BOTH answers!!
    11·1 answer
  • Help pls asap ill give brainliest if u get i right ;)
    9·2 answers
  • Please help me out I'm being timed for this plz look at the picture of the question please and thank you
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!