1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
4 years ago
13

Many large corporations in the U.S. have started campaigns to "go green" and decrease the amount of pollution and waste products

that they release into the environment. Similarly, many companies are labeling their products as "environment-friendly" or "green" without scientifically explaining why their product is better for the environment than a competing product. This type of product labeling A. should be critically evaluated by consumers based on scientific evidence. B. should be critically evaluated based on the company's promotional packaging and presentation. C. is always accurate because companies would never try to deceive consumers. D. is always false and does not need to be evaluated by consumers.
Biology
2 answers:
Leto [7]4 years ago
6 0

Answer:

The correct answer will be option-A.

Explanation:

The "environment-friendly or green" labels on the products sold in the U.S or in other countries indicates that the product is not harmful to the environment.

Although they put a label on the products but they do not provide information on why the products are environment-friendly. This condition forces the consumers to become skeptical to find the reasons.

The consumers, therefore, must critically evaluate the scientific data related to the products about how and why the product is environment-friendly.

Thus, option-A is the correct answer.

denis23 [38]4 years ago
5 0
The answer is A, A is the only answer choice that suggests that the company show scientific evidence.
You might be interested in
1. Is one body system more important than another system?
Ymorist [56]

Your question isn’t clear though each body system holds its prime importance.

5 0
3 years ago
The fluid that enters vertebrate nephrons is called the filtrate. What is the source of the filtrate
Alecsey [184]

the source of the filtrate is Loop of Henle.

The Henle loop is surrounded by tissue fluid with a high ion concentration. Osmosis causes water to move out of the descending limb. As a result of the more concentrated filtrate, ions move out of the loop in the thin ascending limb.

The nephron consists of a single long tubule and a ball of capillaries called the glomerulus. Using hydrostatic pressure, plasma is forced through the walls of the glomerulus, becoming filtrate as it crosses, and then collecting within Bowman's capsule. The fluid that enters vertebrate nephrons is called the filtrate.

<h3>Which part of the nephron is called the loop of Henle?</h3>

A million nephrons are the filtering units of the human kidney, which is a complex and highly vascular organ. Each filters water and solutes from the blood that flows through it into the surrounding space and is the cavity between the cup's walls. The other part resembles a U-shaped loop that transports the filtered fluid deep into the medulla.

<h3>Functions of Nephron</h3>

The primary function of the Nephron is to flush out waste products from the blood, which include solid waste and other excesses. This blood is transformed into urine through secretion and excretion.

The nephron, a basic structural unit of the kidney, is a microscopic structure composed of a renal corpuscle and a renal tubule.

Learn more about Loop of Henle in:

<u><em>brainly.com/question/15488453</em></u>

#SPJ4

5 0
2 years ago
Which of the following genetic variations would most likely lead to an outcome that is successful for that organism?
Ipatiy [6.2K]

Answer:

D

Explanation:

3 0
3 years ago
what accounts for the significant increase in oxygen in earth's atmosphere 2 to 2.5 billion years ago?
sergiy2304 [10]

Given what we know, we can confirm that the significant increase in oxygen in the Earth's atmosphere 2 to 2.5 billion years ago is due to cyanobacteria.

<h3>What are cyanobacteria?</h3>

These are tiny bacterial organisms. They were amongst the first organisms to use photosynthesis to sustain life. The sudden boom of cyanobacteria accounts for the rapid increase in oxygen given that they will use carbon dioxide to produce sugar through photosynthesis, expelling oxygen in the process.

Therefore, we can confirm that the significant increase in oxygen in the Earth's atmosphere 2 to 2.5 billion years ago is due to cyanobacteria.

To learn more about cyanobacteria visit:

brainly.com/question/832454?referrer=searchResults

6 0
2 years ago
Biology help check my answer please
IceJOKER [234]

This is correct, the alligators eat the birds who eat the small fish. They will decrease with an increase in alligators.

5 0
3 years ago
Other questions:
  • Which scientific design has limitations due to oversimplification?
    9·1 answer
  • Which cells of bones secrete the matrix of Haversian canal?
    7·1 answer
  • Is there any corrolation between fibroids and hernias?
    9·1 answer
  • I want to know if this is true or false
    11·1 answer
  • Who discovered DNA ?
    11·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • HELP PLEASE!
    15·1 answer
  • Which molecule provides the cells with quick energy?
    13·1 answer
  • Q.1. Which of the following statements is false?
    14·1 answer
  • How are homeostasis and cellular respiration mutually dependent on one another?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!