Answer:
B. They sold 120 student and 30 adult tickets.
Explanation:
120 x 12 = 1,440
30 x 20 = 600
1,440 + 600 = 2,040.
The color and texture of both things can be used for the upper middle and lower layers of the earth
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Severe anemia may trigger an adaptive conversion of yellow bone marrow to red bone marrow.
Anaemia is defined as the decrease or the reduction of the oxygen carrying content of the blood which are the red blood cells.
These red blood cells and other blood cells which include the white blood cells and the platelets are produced in the body by the bone marrows by a process called haemopoiesis.
The bone marrow is divided into two:
- yellow bone marrow and
- red bone marrow.
The red bone marrow is made up of stem cells which can be converted to red cells when the need arises while yellow bone marrow is made up of fat.
During health conditions such as anaemia, there is increase in the need of red blood cells by the body.
There is usually the conversation of yellow bone marrow to red bone marrow to compensate for the increased demand of red blood cells.
This conversation is called an adaptive conversation.
Therefore,Severe anemia may trigger an adaptive conversion of yellow bone marrow to red bone marrow.
Learn more here:
brainly.com/question/18921249
