During the S phase, DNA is replicated.
Answer:
Three types of population distribution:
Clumped.
Random.
Uniform.
Explanation:
1. Clumped:
This is the most common pattern of population dispersion.
organisms are clustered together in a group.
This may reflect the patchy distribution of resources in the environment.
2. Random:
This is a typical distribution where individuals do not interact strongly.
The organism has unpredictable distribution.
3. Uniform:
This is the typical environment where individuals compete with each other for scarce resources like water in the desert.
organisms are evenly spaced over the area they occupied.
This was previously answered by "Anshults", https://brainly.in/profile/Anshults-4402044
So all credit to them :)
Answer:
It depends on the animal(s)
Explanation:
If its a larger animal such as a lion it would have to be put into a large cage and put into a truck, if its a smaller animal such as a dog you can hold it or also put it in a smaller cage...
It should be
AGATACCATGGTTACCCGGTTCCA
The answer is written on hand, and sorry for that because I am on driving having no resources except hand and ball point to solve your problem. Sorry for that however answer is given.