1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
10

The process of cellular respiration, which converts simple sugars such as glucose into CO2 and water, is an example of _________

_.
(i)-a pathway in which the entropy of the system decreases
(ii)-a catabolic pathway a pathway that converts organic matter into energy
(iii)-a pathway that occurs in animal cells but not plant cells an endergonic pathway
Biology
1 answer:
nalin [4]3 years ago
6 0

Answer:

ii) A catabolic path way.

Explanation:

There are two types of respiration:

1. Aerobic respiration  

2. Anaerobic respiration

Aerobic respiration

It is the breakdown of glucose molecule in the presence of oxygen to yield large amount of energy. Water and carbon dioxide are also produced as a byproduct.

Glucose + oxygen → carbon dioxide + water + 38ATP

Anaerobic Respiration

It is the breakdown of glucose molecule in the absence of oxygen and produce small amount of energy. Alcohol or lactic acid and carbon dioxide are also produced as byproducts.  

Glucose→ lactic acid/alcohol + 2ATP + carbon dioxide

This process use respiratory electron transport chain as electron acceptor instead of oxygen. It is mostly occur in prokaryotes. Its main advantage is that it produce energy (ATP) very quickly as compared to aerobic respiration.  

You might be interested in
What occurs during the S (synthesis) phase of the cell cycle?
erica [24]
During the S phase, DNA is replicated.
6 0
3 years ago
Name the three types of population distribution, describe each, and explain the conditions that govern each.
mel-nik [20]

Answer:

Three types of population distribution:

Clumped.

Random.

Uniform.

Explanation:

1. Clumped:

This is the most common pattern of population dispersion.

organisms are clustered together in a group.

This may reflect the patchy distribution of resources in the environment.

2. Random:

This is a typical distribution where individuals do not interact strongly.

The organism has unpredictable distribution.

3. Uniform:

This is the typical environment where individuals compete with each other for scarce resources like water in the desert.

organisms are evenly spaced over the area they occupied.

This was previously answered by "Anshults", https://brainly.in/profile/Anshults-4402044

So all credit to them :)

6 0
3 years ago
Read 2 more answers
How should tame animals be moved ?
Rama09 [41]

Answer:

It depends on the animal(s)

Explanation:

If its a larger animal such as a lion it would have to be put into a large cage and put into a truck, if its a smaller animal such as a dog you can hold it or also put it in a smaller cage...

3 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
6 to the second power divided (6+3)+18÷3-3 to the second power show your work will mark brainiest
katovenus [111]
The answer is written on hand, and sorry for that because I am on driving having no resources except hand and ball point to solve your problem. Sorry for that however answer is given.

4 0
4 years ago
Read 2 more answers
Other questions:
  • Vision and visual perception occur in the __________ lobe.
    10·1 answer
  • Memories result in the formation of new neurons. true or false
    7·2 answers
  • Even though part of it is nonliving, ____ functions to protect the living parts of the stem
    10·1 answer
  • For the first time in five years California authorities have issued a first stage smog alert, warning people in some areas of un
    7·2 answers
  • Ian waterman was able to sense pain and temperature because his _____ pathway was intact, but could not feel touch and limb posi
    11·1 answer
  • What type of a consumer is krill?
    7·2 answers
  • Carbon is the element of
    7·1 answer
  • Select the FALSE statement below about the structure of myoglobin.
    11·1 answer
  • 13)
    5·1 answer
  • QUESTION 6<br> What do red blood cells do?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!