1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
3 years ago
9

If the stem of a plant is bent or snapped, why does the part above the bend usually die, even if it is propped up with a support

?
Biology
1 answer:
Georgia [21]3 years ago
3 0
 There are inner part of the stem and outer part of the stem; in a plant the inner part supports the movement of the water and nutrients. You stop the flow of the vital elements of plant growth when you snap the stem and this is the reason why the plant die due to starvation of the nutrients. 
You might be interested in
A Biome is made up of a combination of living and non-living things. The living things you find will vary greatly based on clima
Alina [70]
True. Need at lest 20 characters
5 0
3 years ago
Which is a tough and rigid layer that surrounds plant cells, as well as some algal and bacterial cells?
Lemur [1.5K]
I’m sorry if this is wrong but cell wall
7 0
3 years ago
Read 2 more answers
How are babies made?
Reptile [31]

Answer:

The genetic material in the sperm combines with the genetic material in the egg to create a new cell that starts dividing rapidly. You're not actually pregnant until that bundle of new cells, known as the embryo, travels the rest of the way down the fallopian tube and attaches itself to the wall of your uterus.

Explanation:

7 0
2 years ago
PLEASE ANSWER NUMBERS 7, 9, 19, 16, 20,21,22,23,24
Verizon [17]

Explanation:

if u read the passage then u would know it so i prefer going thru passage and reading questions

4 0
2 years ago
Is infant circumcision ethically necessary?
Nostrana [21]
The answer is that infant circumcision is not ethically necessary. The reason to this is that there are no proof of evidence as to why it is ethically necessary for it to be done to an infant. It is also because other medical professionals thinks that doing circumcision in an infant will create issues in terms of their health, producing complications. That is why it is not ethically necessary for it to be done on an infant.
6 0
3 years ago
Other questions:
  • During cell division, or mitosis, an exact duplicate of the original cell is produced. The instructions for cell division are fo
    9·2 answers
  • How does cryptosporidium pass from one organism to another? Be specific.
    14·1 answer
  • Which of the following best defines sustainable fishing practices?
    7·2 answers
  • A chromosome is composed of 2 ____ hooked together by a ____.
    9·2 answers
  • How are climate change and climate variability related?
    14·1 answer
  • Which has prokaryotic cells
    14·2 answers
  • Which process does not break down glucose
    6·2 answers
  • In what part of a mitochondrion does the krebs cycle occur
    6·1 answer
  • If a researcher has a DNA sample with a concentration of 0.6 micrograms per microliter, how many microliters of DNA must be tran
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!