1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
7

What is carried to the body cells by blood? pick 2

Biology
1 answer:
Reil [10]3 years ago
3 0

Hey, it’s Nutrients and Oxygen

You might be interested in
Type the correct answer in the box. Spell all words correctly.
Anit [1.1K]

Henry Faulds and Galton are cousins which both helped each other like Faulds wrote a book about fingerprints which helped Galton out a lot.

Faulds was also the Father of Fingerprinting.

hope i helped ~Zuzu :)

7 0
3 years ago
Read 2 more answers
What is the energy from the Sun used SPECIFICALLY for in Photosynthesis?
Rom4ik [11]
Its helps pull apart the molecule water
to get the electrons from it
3 0
2 years ago
Read 2 more answers
The incoming infrared radiation from the sun as it travels towards earth is
Brilliant_brown [7]
Most of the infrared radiation to the Earth is absorbed and transmitted towards the Earth's surface.
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Adaptations are important for the survival of both animals and plants. A plant such as the cactus has many adaptations that help
posledela

I think c (it makes getting water easier and and quicker for the cactus

6 0
3 years ago
Read 2 more answers
Other questions:
  • 1. Describe in your own words how competition may leads to natural selection.
    5·1 answer
  • Transpiration depends directly upon what? condensation, evaporation, turgor, or precipitation
    15·1 answer
  • Malthus formed his theory by studying factors that control the population growth of humans. How might factors operating on organ
    14·1 answer
  • Which group of macromolecules is used for storing genetic information?
    15·2 answers
  • Which of the following are characteristics of<br> Zygomycota? Check all that apply.
    9·2 answers
  • Type B blood has type B markers on red blood cells, .......... antibodies in the plasma, and can donate blood to types........
    11·2 answers
  • Pls help asAP PLS❗❗❗❗❗❗❗❗❗❗❗❗❗❗
    10·1 answer
  • Which of these statements about budding is FALSE?
    9·1 answer
  • What happens when humans burn fossil fuels?
    6·1 answer
  • How can you detect hardness of water collected from different sources​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!