1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
10

Brown eyes are dominant over blue eyes. This is NOT a sex-linked trait. Cross a brown-eyed colorblim

Biology
1 answer:
amid [387]3 years ago
8 0

Answer:

what

Explanation:

You might be interested in
As a rule, the teeth in a given mammal's mouth look very similar because they all have the same function.
Sholpan [36]

Answer: False

Explanation:

The teeth of mammals do not have the similar function to perform. They have different types, number and sizes of teeth that are equipped to perform different functions.

Example: Human beings have incisors,canines, molar and premolar. The incisors are used to cut the food and hold the food.

The canines are use to tear hard food such as meat. The molars and premolars are used to grind the food.

Hence, the given statement is false.

5 0
3 years ago
what condition is a major contributor to disability and placement in nursing homes for those over age 75 and is often accompanie
Rina8888 [55]

Answer:

Dementia

Explanation:

Dementia is a condition that involves impaired mental ability and memory which is common among older adults. This condition, which is a major contributor to disability and placement of older adults in nursing homes, can be as a result of several factors of which nutrition has a major role to play. Metabolic and endocrine problem that results to the inability of the body system to regulate nutrients such as calcium and vitamin B-12, are some of the factors that triggers dementia in older adults. Also, nutritional deficiencies such as dehydration, inadequate intake of vitamin B-1, vitamins B-6, copper,vitamin E, and vitamin B-12 increases the chances of developing dementia in older adults.

Research shows that low levels of vitamin D can be linked to increased risk of developing dementia, and as such, supplements such as B-complex vitamin, vitamin C, and vitamin D is usually recommended for the prevention of dementia, especially when they are deficient in the diets taken.

7 0
3 years ago
What is transduction? (circle all that apply)
andrew-mc [135]

Answer:

The correct answer will be option- B.

Explanation:

The Transduction is the process of the genetic transfer by which the foreign DNA is incorporated in the genome of the cell using virus or bacteriophage. The process of transduction was discovered by the Zinder and Lederberg in 1952 in the species of<em> Salmonella</em> bacteria. The transduction process is of two types: generalized and specialized transduction.

Thus, option- B is the correct answer.

7 0
3 years ago
3)
Margarita [4]

Answer:

mRNA:   A-U-G-C-A-U-U-A

Explanation:

Given DNA template: T-A-C-G-C-T-A-A-T

Newly transcribed  mRNA:  A-U-G-C-A-U-U-A

Transcription is a process that uses DNA template strand to make RNA strands. The process occurs in nucleus. The nucleotide sequence of DNA template is always complimentary to its respective RNA sequence.

Here, thymine of DNA template strand pairs with adenine of newly formed RNA. Adenine of DNA template would pair with uracil of RNA. Guanine of DNA template pairs with cytosine.

8 0
3 years ago
What happens to urchins if the oxygen percent concentration drops too low for an extended period of time?
makkiz [27]

Answer:

Since sea urchins are picky, they are used as indicator organisms in public aquariums to determine if the system is functioning properly. This is because they are very "picky" about water quality. If the water is contaminated, the sea urchins will be the first to show signs of stress, spines laying down or falling off. Do use an aquarium filter and do clean up the day after feeding. Any metal exposed to the seawater will corrode and poison the tank. A dying sea urchin will often spawn out and rot out, causing the others in the tank to spawn and die as welll.

Explanation:

7 0
2 years ago
Other questions:
  • What caused Pangaea to break up?
    11·2 answers
  • Growth in length is
    13·1 answer
  • What's jetstream affect the weather in Antarctica
    12·1 answer
  • Many organisms can reproduce asexually through mitosis, while other organisms reproduce sexually, and their cells carry out meio
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Niles Eldredge found evidence in trilobite fossils of a pattern of evaluation in which short periods of large change are mixed i
    7·1 answer
  • What makes a chaparral different from a desert?
    15·1 answer
  • PLEASE HELP ME !!!
    14·1 answer
  • When a capillary is damaged, a platelet plug formed. The process involves platelets sticking to each other. The more platelets t
    9·1 answer
  • A unique strain of grape variety is called what<br> Strain<br> Clone<br> Variety<br> Hybrid
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!