1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
9

​when stressed, the body's _____ response prepares it for quick action by pumping more blood to the legs and arms, tensing muscl

es, increasing breathing rates, and increasing alertness and awareness in the brain.
Biology
1 answer:
alexandr402 [8]3 years ago
8 0
The correct answer is fight or flight.
The fight or flight response also called acute stress response, is a physiological response to a perceived attack, threat or in general any stressful event. This reaction consists the first stage of the general adaptation syndrome, which is the mechanism that regulates the response to stressful situations.

This response consists of an activation of the autonomic nervous system and a cascade of hormones, including catecholamines, cortisol, estrogen, testosterone, and dopamine. This hormonal cascade results in many physiological changes which prepare the body for action.
You might be interested in
What are the functions of veins ?
coldgirl [10]

Answer:

They are veins and arteries. The primary function of arteries is to transport highly oxygenated, nutrient-rich blood from our hearts and distribute it to the rest of our body. Veins, on the other hand, are used to pump much-needed blood back to the heart.

7 0
3 years ago
Read 2 more answers
What specific part of the cell/structure allows the mucus secretions to be thick and viscous rather than fluid (i.e., is it a me
Ksenya-84 [330]

Answer:

The CFTR behaves like a channel for chlorine. Its dysfunction affects both the transport of this ion and other ions and the transport of water, which causes a thickening of secretions, an alteration of mucociliary transport and local defenses, facilitating bacterial colonization and promoting the release of pro-inflammatory mediators in the airway

Explanation:

CFTR is a protein expressed in the epithelial cells of the respiratory system, pancreas, bile ducts, sweat glands and genitourinary system. It is made up of a single chain made up of 1,480 amino acids. It contains 12 hydrophobic regions embedded in the lipid membrane and acts as a channel for chlorine.The highest levels of expression of the CFTR protein are found in serous cells of the submucosal glands of the proximal airway. In them, Cl- is released to the outside. In addition, there are channels for Na +, through which this ion is also secreted in the same direction. These movements cause the displacement of water and also of mucins, originating in the submucosal glands, allowing their presence on the surface of the airway. For all this to occur normally, a basolateral Na + - K + - ATPase cotransporter must function, another basolateral cotransporter formed by Na +, K + and 2 Cl-, which allows the latter to enter the cell, and an apical CFTR channel through which it exits the Cl- of the cell towards the acinar lumen. Na + leaves the cell following Cl- by a paracellular pathway accompanied by water. When CFTR malfunctions, Cl- does not exit through this channel and this implies a decrease in Na + and water in the canalicular lumen, with the consequent thickening of secretions.

8 0
2 years ago
CRISPR-Cas9 is a genetic modification technique that edits parts of the genome of an organism. Using this technique scientists c
chubhunter [2.5K]

Answer:

Explanation: is A :)

3 0
3 years ago
Read 2 more answers
4. Which of the following is not a typical function of a cell membrane?
rewona [7]

Answer:

storage of sugar is no a typical function of a cell membrane

Explanation:

7 0
3 years ago
Conservationists establish that the carrying capacity of a population of deer in an extensive geographical area is 945. The curr
Eva8 [605]
The correct option is E.
The carrying capacity of a biological specie in an ecosystem refers to the maximum population size of the specie that the environment can sustain indefinitely given all the resources that are available in the environment. When the number of living organism in an ecosystem is above the carrying capacity, the number of death among the specie will increase until the carrying capacity is reached. 
7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is heating a gas in acontainer dangerous?
    13·1 answer
  • Which of the following are characteristics of ultramafic igneous rocks
    13·1 answer
  • What is the antonym of antibiotic
    15·1 answer
  • Which of the following genotypes could be described as heterozygous?<br> В. АА<br> оооо<br> SUBMIT
    6·1 answer
  • Explain why living organisms contain more hydrogen atoms than any other atoms, yet 65% of s typical organisms mass in oxygen
    6·1 answer
  • Mollis and mushrooms are both____
    7·1 answer
  • Which fungi group has members that possess centrioles?
    8·2 answers
  • 5 the main predators of field mice in a certain ecosystem are rattlesnakes and foxes. suppose humans begin building neighborhood
    5·1 answer
  • In what part of the day do plants produce more carbon dioxide than oxygen?
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!